Comments not related to petroleum in this thread, please.
Well, I can’t think of any consumers of oil (from Texas to Maine, from London to Seoul) who aren’t exposed…
Comments not related to petroleum in this thread, please.
Well, I can’t think of any consumers of oil (from Texas to Maine, from London to Seoul) who aren’t exposed…
These projections seems pretty obvious, as some of have pointed out here recently- “International Energy Agency chief Fatih Birol says…
Fossil fuel advocates would have us believe they can build a fire brighter than the sun. The hubris is unbelievable.…
Ovi, A higher horsepower frack spread allows more wells to be fracced at one time and likely allows more wells…
Dennis WRT rigs, the higher HP power results in shorter drilling times or longer wells. Switching to efracs does not…
375 responses to “Open Thread Non-Petroleum, April 19, 2017”
The IEA Photovoltaic Power Systems Programme web site just published their 2016 Snapshot of Global PV Markets summarizing the activity in the global PV markets for 2016. The graphic below best sums up the year, a massive push by China to get lots of PV installed!
At 78.1 GW of cummulative capacity installed, China falls just 7.5 GW short of having twice as much PV as the country with the second largest cummulative capacity, Japan at 42.8 GW. There are a couple of other interesting take aways, looking at data from last year’s international survey report on Trends in Photovoltaic (PV) Applications up to 2015 provided to you by the IEA PVPS. The capacity installed by China in 2016 was 5 GW short of the amount installed worldwide in 2010, that is, in 2016 China installed 87% of the capacity that was added worldwide in 2010. The amount of PV capacity installed in the US in 2016, was slightly less than the capacity installed worldwide in 2008 and would have qualified for the largest amount ever added by a single country as recently as 2014 (in 2015 China added 15.5 GW).
The growth in the PV market is beginning to look like it is enetering bubble territory. If it continues at this rate, PV will start to displace fairly new FF capacity in a serious way before long (less than five years is my WAG). Maybe that’s why the FF industries are so “up in arms” about the “massive” subsidies being given to renewables. 😉 It also seems that there is a somewhat unhealthy dominance of China in the PV manufacturing arena. Is there any other critical industry where so much manufacturing capacity resides in just one nation? I guess computers, mobile phones, TVs (screens) and semiconductor based industries in general might qualify but, I am somewhat uncomfortable with so much manufacturing capacity being concentrated in one country,
Any body with an abc level knowledge of history should be at least concerned to alarmed when any country, other than his own, or at least one very closely allied with his own, dominates an industry critical to the future to such an extent.
It’s not just the actual manufacturing of the end product. There are hundreds and thousands of specialty trades and professions and businesses that provide in puts and services to large high tech industries, and the countries WITHOUT the manufacturing capacity are all too apt to find themselves falling farther and farther behind, eventually to the point they have no real hope of ever catching up again.
When a locality, or a country loses out big time in any given industry, it means the collateral support for other industries shrinks both in terms of capacity and capabilities.
In my neighborhood, we used to have very well stocked industrial supply houses, and very high class machine shops capable of turning out one of a kind equipment, made to order.
These supply houses are mostly gone, and the machine shops are mostly gone, and this means we are less well situated to attract new industries that need this sort of support. They’re gone because the furniture and textile industries were mostly shipped overseas.
There are such things as tipping points in economics, just as there are in climate.
Clothes are junk products now as are shoes.
US manufacturing is doing just fine, it is 30 percent above it’s 2009 low and rising lately. It’s real output is almost double 1988 output. The US is the second largest manufacturer in the world.
You are correct about textile mills. Employment is around 120,000 in the US currently and was 500,000 back in 1990. The paper industry employment went from 650,000 to 350,000 in that time period. Both industries are running fairly flat now.
Similarly apparel manufacturing has taking a 80% loss in employment since 1990, from about 1 million employees.
Computers and electronic manufacturing has fallen by 50% in the US since 1990.
It’s hard pressed to find a manufacturing sector that has not lost employment.
Yet manufacturing output is up 260% in the last four decades.
Gross output of U.S. manufacturing industries — counting products produced for final use as well as those used as intermediate inputs — totaled $6.2 trillion in 2015, about 36% of U.S. gross domestic product, nearly double the output of any of the other big sectors: professional and business services, government and real estate.
http://www.marketwatch.com/story/us-manufacturing-dead-output-has-doubled-in-three-decades-2016-03-28
Manufacturing as a whole is doing ok, true. But there’s no reason, really, to believe that the human naked ape has or will change it’s stripes, to make a mixed metaphor, and that the world will remain peaceable from here on out. It’s never really been at piece, except at odd times, since the nation state evolved into something big enough to make war over long distances.
I personally don’t like the idea of having to go hat in hand asking our potential first or second worst enemy for supplies of materials critical to our economy when it looks as if bullets and rockets may soon be flying.
Now clothing we could buy just about anywhere, no problem, for the next fifty years, there will always be some poor country willing to make clothing as one of the first steps up the industrialization ladder, and enough people doing it in such countries we are not going to be at risk of becoming involuntary nudists, lol.
But the folks who argue such issues on the basis of economics textbooks and comparative advantage,etc, are trapped inside an intellectual box that sits inside a larger actual reality.
The exportation of countless textile and furniture industry jobs has had a hell of a lot to do with political outcomes here in the USA, one such being the R party take over of states where these industries were concentrated.
Of course it WAS the R party that played the larger role by far in the workers in these industries taking this hit, but HRC was politically stupid enough to run as a globalist last time around, this being one of the many straws that could be THE one that broke her camel’s back, given how close it was in the last three big rust belt states Trump won.
And while we as a whole can survive just fine without furniture and textiles, the folks who support globalization NEVER NEVER NEVER seriously acknowledge the indisputable truth of the actual price we paid in allowing these industries to be exported. More trouble of every sort has been the consequence in former textile and furniture towns and rural areas, more social workers, more cops, more crime, more broken families, more people on welfare, greater income inequality, etc.
And nobody has ever paid more than lip service, really, to actually doing anything for the people who got screwed. You can’t change a middle aged man or woman who can barely read a newspaper or balance a check book into a high tech worker for an industry that does not exist locally, and has zero desire to locate locally. That sort of talk is complete and total BULLSHIT and it takes an IDIOT to believe it.
But you CAN change such a person into a voter who will vote his or her rage at the first opportunity.
Now would all the people who are doing well or great be better off wearing clothing imported from third world workshops, or paying a few bucks more for domestically manufactured, considering the political price they have paid?
A straw here, and a straw there, and pretty soon you’re talking about a real load of hay, enough to bring about political tipping points.
he folks who support globalization NEVER NEVER NEVER seriously acknowledge the indisputable truth of the actual price we paid in allowing these industries to be exported. More trouble of every sort has been the consequence in former textile and furniture towns and rural areas, more social workers, more cops, more crime, more broken families, more people on welfare, greater income inequality, etc.
Except…it’s not true. It’s just not true that this unemployment was caused primarily by offshoring. It was mostly caused by automation, right??
Was it a mistake for HRC to not lie like Trump about lost manufacturing employment (not to mention offshoring), and pretend that it could and would be reversed? Perhaps. Perhaps it was not politically smart to be honest about the future of these kinds of jobs (maybe she would not have taken that risk if the polls had been accurate).
But, leaving aside the “inside baseball” of political strategies…we should acknowledge the truth. Offshoring was not the primary cause of the problems of people with educations at high school or below – it was automation.
Right?
Hi Nick,
It was my impression, that in the late 90’s and early 21st century offshoring was mostly the problem. But for the last 10 years it’s been automation. On top of that, add into the mix. The loss of influence of unions, increase cost of higher education and influx of hard working immigrants. The unskilled and poorly educated don’t stand much of a chance today of any quality of standard of living. Then there is also the do nothing congress for the last 8 years and the public that demonizes government.
Personally, I’m a supporter of Keynesian economics and felt the 2009 stimulus was to small and Obama should have fought harder at the time for it to be bigger. The sooner the economy got back on it’s feet. The better everyone would have been(the Republicans knew that). I also feel the country can’t agree on a direction. Like the space program or interstate highway system. Just cutting taxes and more military spending is not a fix. Transforming to a low CO2 energy platform economy would be a great direction, but the fossil fuel industry has been fighting that all the way. Which in the long run, will leave America farther behind the rest of the world instead of leading it.
Good to see you back
Thanks!
I agree with your thoughts, generally.
I’m often surprised how much most people don’t understand labor productivity.. People think “robots”, or “automation”, and think it’s new, but over the history of the US (and the modern world), increasing labor productivity has been the primary driver of rising prosperity (and job loss!) It’s been an accumulation of knowledge about how to get work done faster and better. As that knowledge has accumulated, change has accelerated. People think specific inputs, like energy, or trade, or metals, etc., are the secret sauce – if any one of them had been missing, it would have slowed things down, but not forever.
That means job loss. Agriculture has gone from 50% of jobs to 2% in the last century. That’s dramatically reduced the cost of basic food, but those workers had to go somewhere else. The US is still a net exporter of food, but…ag employment has disappeared. Now, manufacturing is going through the exact same thing.
So, prosperity means disruption: people changing jobs, industries disappearing and being replaced by other industries. And disruption is often very, very painful. The Okies were displaced by tractors; the UAW workers were displaced by inexorable improvements in assembly line productivity. They went through hard times – some recovered and did better than before, some never recovered. Republicans push policies that hurt such people (ACA repeal, etc), Democrats do somewhat better.
Offshoring is real. US manufacturing output more than doubled from 1979 to 2000, but manufacturing employment didn’t grow – it stayed flat due to growing labor productivity. Then, around 2000 China joined the WTO, and after that US manufacturing stopped growing. That meant growing labor productivity caused employment to drop quickly.
The bottom line: most of the crash in manufacturing employment was caused by “automation”. Offshoring has played a part, but when politicians blame unemployment on imports, they’re scapegoating.
Now, why does it feel like it’s due primarily to imports? One reason I can think of: as automation shrinks employment, at some point fewer factories are needed, and the work will be consolidated into fewer locations. Those closings tend to be blamed on offshoring, especially if the remaining factory is in a lower wage location, e.g., a furniture factory in Grand Rapids MI is consolidated into a factory in N. Carolina.
There is another factor also. Jobs are being eliminated without any substitute. Three jobs may become one with one person covering three locations. Not to say the job will be done as well, but the cost is less for the companies. I have seen whole departments eliminated and the jobs spread to the other employees. Tacking on tasks and then expecting improved productivity is a common ploy in corporate America.
It’s a hidden way to reduce costs. Management positions are very susceptible to this type of head cutting.
Correct, it’s more than just manufacturing. It’s managing and tracking employees. No more utility meter readers, scanning your own purchases at the store, assisting outside sales and service. Plus soon the elimination of drivers.
The elimination of jobs through technology has been discussed and taken place over decades, likely centuries. It’s nothing new. Meanwhile we have essays, such as from the likes of Graeber, talking about the ‘phenomenon of bullshit¹ jobs’. Bullshit² jobs aren’t really anything new, either. Most jobs are probably bullshit³, in a bullshit⁴ so-called economy.
It is suspected that, despite the bullshit⁵, this time, it is less so much about technology, as about the underlying issue of general decline– nothing new there either of course…
In a pre-peak oil era with a ‘hot-running bullshit⁶ economy’, bullshit⁷ jobs could be relatively-easily manufactured. Not so much this time around.
“Except…it’s not true. It’s just not true that this unemployment was caused primarily by offshoring. It was mostly caused by automation, right?”
It’s true that a substantial number of manufacturing jobs have been lost to automation, no doubt at all.
But it’s also true that millions were lost to being exported. The fact that a lot of lost jobs were lost to being automated does NOT mean the D’s didn’t pay the price by losing the WH because of the ones that were exported.
The fact that jobs were lost to automation does NOT CHANGE the political calculus, or the lives of people who lost their jobs due to their jobs being exported.
NICK, notice that I say right up front that the R’s are actually the ones mostly responsible for exporting our lost industries.
You always or nearly always respond as a partisan, minimizing or denying any facts that don’t suit the D party agenda, or that illuminate why the D’s are in the political dog house.
It’s also true that the people in communities that lost these jobs have suffered immensely, and that hardly anything has ever been done by either party to make up for it.
It would not have been necessary for Clinton to tell any additional lies to the many she has told, taking note of the fact that when it comes to lying, Trump makes her look like a six year old Girl Scout. All politicians tell lies, some are better at it, and some tell a lot less than others. Clinton doesn’t tell ten percent as many as Trump. Unfortunately some of the ones she told rang untrue with ENOUGH voters who abandoned the D’s for the R’s this last time around.
Keep in mind that it’s possible to tell lies by OMISSION as well as commission. Spend all your time with banksters, and politically potent but relatively tiny voting blocks, and ignore OTHER, MUCH LARGER voting blocks, and the larger block DOES notice it has been snubbed, and a few remarks here and there will NOT be enough to convince the snubbed voter he or she still matters.
Quite a lot of people voted for Trump not because they wanted Trump, but to send an unmistakable message to the D party, and to the R party establishment as well, when you get right down to it.
All that she would have had to do is have had sense enough to hang around less with banksters, and Holly Wood types, and got out among the people who are the real core, or used to be, the real core of the Democratic Party, and campaigned AMONG THEM like she meant it, without EMPHASIZING the issues that turned off voters scared for their jobs.
She could have hung with banksters QUIETLY. She and her dogs could have talked RESPECTFULLY to and about Sanders voters, rather than playing every possible dirty trick to manipulate the primaries.
Perceptions have as much or more to do with winning elections as actual facts.
She lacked political savvy enough, enough FEEL for the mood of the country, to understand what was going on.
I believe Bill C tried to tell her, but she was determined to listen to her yes guys and girls, rather than the guy who is arguably the smoothest and sharpest politician of recent vintage, going back at least as far as Ronnie Raygun, who also had the common touch in spades.
Well this is plain Bullshit !
First off, you should have posted this comment under the screen name Trumpster.
Second, these types of posts are suppose to be for me. If you going to start writing around on me. Then we’re over and I’m filing for divorce. Then, this is truly going to get ugly and I don’t think your ready for that. So, just put your very little hands back in your pockets and go back to business as usual.
So tell your little boyfriend Nick that it’s over and don’t let it happen again.
The fact that a lot of lost jobs were lost to being automated does NOT mean the D’s didn’t pay the price by losing the WH because of the ones that were exported.
Yes, it does. Trump claimed that offshoring was THE problem. That’s not true. It’s not the main problem. Most of those jobs would have been lost anyway.
So, if people voted for Trump because of “offshoring”…they were voting based on a lie.
The fact that jobs were lost to automation does NOT CHANGE the political calculus
Yes, absolutely it does. It makes a big difference that 80% of the job losses were due to “automation”, and that they are NOT coming back.
Trump claimed he could bring them back. It’s NOT true.
notice that I say right up front that the R’s are actually the ones mostly responsible for exporting our lost industries.;
That’s true, but not relevant. The main thing is that…exporting industries was not the main thing.
You always or nearly always respond as a partisan
No. You’re not hearing what I’m saying. I don’t care about big D tactics. Or big R tactics. I’m talking about the big picture, the fundamentals. Not (mostly) this election.
I like to describe the (imaginary) guy who lives in the midwestern town that used to have a couple of small manufacturing companies and had modest but rising prosperity in the ’50s, 60’s 70’s. He sent his kids to college or not, but they both got jobs and bought homes and raised families. Their kids grew up shopping at the new Walmart store and hardly noticed when they grew up that the downtown was disappearing because they were so busy, now that both of them had to work. Pretty soon the jobs kept getting tougher and the factories were closing. BigAg, though was doing well, factory farms. Nafta traded those crappy little manufacturing jobs for massive sales of corn to Mexico, putting Mexican farmers out of business.
Now our little mid-western community has one big rich farmer, twelve meth dealers, and the Chevy dealer went bankrupt.
But they still have Walmart. The clerks don’t speak English very well and everything is made in China. Maybe automation was bad for their factory jobs but what they see is what got Trump elected. Unfortunately he saw all of this, used it but basically doesn’t care now that he won the prize.
Maybe automation was bad for their factory jobs but what they see is what got Trump elected.
No, it’s not what they see, it’s how they interpret what they see. First of all, of course, the real change factor is “automation”. But Fox News, and talk radio, tells them that it’s all the fault of imports and aliens.
And so, they see Chinese products, and remember them, but don’t remember the ones made in the US and don’t even think about the enormous quantities of stuff that’s exported from the US (planes, trains and autos, oil products, grain, etc); they see someone who looks hispanic, and assume they’re illegal or a recent immigrant (though their ancestors may have been in the very large portions of this country which were seized from Mexico); they hear about factory closings and assume it’s because of offshoring.
But who should take responsibility for the other things you mention? How about the local shoppers who choose to give their money to the multi-multi-billionaire children of Sam Walton, who underpay their clerks so that they have to live on food stamps; the local voters who vote for politicians that keep out unions, and solicit car companies who relocate their factories to places like Tennessee because of “right to work”, so that the factory jobs don’t pay a living wage; who vote for politicians who refuse to provide Medicaid coverage through the ACA, even thought the federal gov would pay the bill, so residents can go bankrupt paying inflated medical bills; who buy chinese products because they appear slightly cheaper (though they often are inferior and don’t last).
How about the people who vote for politicians who promise to cut taxes, but never notice that the tax cuts are only for the wealthy, because Fox News doesn’t tell them?
Ask the local residents if they’d pay more for something made in the US; ask them if they’re willing to pay more (much, much more) for cars, groceries and shoes so that manufacturers don’t have to find ways to reduce costs by making factories use fewer labor hours. If they say yes, then watch them, and find out that they don’t.
This is the Chinese century. We passed the tipping point a while back now. Reagan/Bush I decided to make *sure* that we lost the economic lead to China. Too late to change that now.
If I were younger, healthier, and better at languages and I wanted to have a future successful career I’d move to China.
They used to say the same thing about Japan 25 years ago.
‘This is the Chinese century’ ‘talking-point meme’ is ‘so last century’. ‘u^
You only see the tipping point in retrospect. Now that China controls all the major strategic industries in the world… *and* has the most statesmanlike government of any major power… y’know… it’s become clear what happened.
Will it last a century? Maybe not. But the point is, the US is definitively #2 now.
Don’t forget to write
The panels aren’t such a big deal. The polysilicon is more important, and production is more spread out.
That said, I agree that America needs to do something about its declining industrial competitiveness. I think the solution is to nurture communities where people who know how to build a run factories live.
>Any body with an abc level knowledge of history should be at least concerned to alarmed when any country, other than his own, or at least one very closely allied with his own, dominates an industry critical to the future to such an extent.
America has been heavily dependent on foreign oil for decades, but nobody cared enough to take obvious counter-measures like reasonable taxes on oil, sensible transportation planning etc. I doubt anyone will care about solar panels.
Hi Islandboy,
Is there data on PV output? The output numbers are what matters as capacity doesn’t always result in the same output increase as location determines utililization rates, so output or consumption is the key data.
To the point Dennis is making, the capacity factor is a key aspect of a power plants output. For example, a nuclear plant typically has a capacity factor of 80-90%, because its needs to be taken offline for periodic maintenance and refueling, so it can’t be running full speed 100% of the time. If it could, it would have a CF of 100%.
Typical wind energy CF in windy spots is 25-40%.
The PV data presented here is the nameplate capacity (max output if in Sahara direct sun 24/7/365). PV annual kwh production is a much more important number.
Nonetheless, great trend.
btw- I sure wouldn’t want to see trump tariffs imposed on Chinese PV, just so we could have more expensive panels made in USA.
Capacity Factor- https://en.wikipedia.org/wiki/Capacity_factor
CANDU reactors can be refueled while in full operation, yet they are not being operated at higher capacity factors than conventional PWRs are.
There’s always a huge discrepancy between nuclear promises and nuclear reality.
The nukes in my neck of the woods have performed admirably ever since they were put into service, and although they are now nearing the end of their life cycle, they are still running in the high eighties, and low nineties, in terms of capacity, and even setting some performance records in recent years.
PV nameplate capacity has nothing to do with the Sahara. It is the peak power the PV module produces under standard test conditions. These standard conditions include allowing for an air mass co-efficient of 1.5. From wikipedia,
“AM1.5”, 1.5 atmosphere thickness, corresponds to a solar zenith angle of z=48.2°. While the summertime AM number for mid-latitudes during the middle parts of the day is less than 1.5, higher figures apply in the morning and evening and at other times of the year. Therefore, AM1.5 is useful to represent the overall yearly average for mid-latitudes. The specific value of 1.5 has been selected in the 1970s for standardization purposes, based on an analysis of solar irradiance data in the conterminous United States.[9] Since then, the solar industry has been using AM1.5 for all standardized testing or rating of terrestrial solar cells or modules, including those used in concentrating systems.”
My bold. Solar panels can achieve above their nameplate peak power at lower latitudes.
An interview with battery researcher Jonny B Goodenough (har har)
https://hardware.slashdot.org/story/17/04/19/016213/the-slashdot-interview-with-lithium-ion-battery-inventor-john-b-goodenough
http://finance.yahoo.com/news/just-got-huge-sign-us-161647845.html
How A War With North Korea Would Play Out
Assuming an attack is successful, North Korea would face the question of how it would respond. It has two options. The lesser of the two, which North Korea appears to have threatened, is to attack American citizens in South Korea, including kidnapping and extracting them to North Korea. A far more significant counter would be to use its heavy concentration of artillery along the western section of the border with South Korea to initiate extremely intense shelling of Seoul.
http://www.huffingtonpost.com/entry/what-a-war-with-north-korea-looks-like_us_58f7740ae4b0f5cf16c7bb19?42a&ncid=inblnkushpmg00000009
And to think, if HRC were President. She could have probably just emailed Kim Jong-un with spam of mass destruction.
Is North Korea kind of a distraction, such as for the relative and utter ineffectuality of the current admins?
Yes.
NAOM
This link is longer than most posted here, but it’s chock full of food for thought about climate issues.
https://phys.org/news/2017-04-streaming-antarctica-survey-liquid-widespread.html
This one is was an eye opener for me. I had no idea there was so much melting going down below.
Mass loss
https://climate.nasa.gov/vital-signs/land-ice/
Makes sense since the southern ocean has absorbed the most heat.
Tainter. Collapse. An oldie but a goodie.
https://youtu.be/RSXKjH_WjWo
Ice thickness image
http://polarportal.dk/fileadmin/polarportal/sea/CICE_map_thick_LA_EN_20170418.png
Do you have a call for the day of maximum volume, it looks close?
Keeling curve CO2 was over 410 for April 18th, I think that is the first time ever.
April 18, 2017: 410.28 ppm
April 18, 2016: 407.80 ppm
But the rate of increase is less than 3 ppm now, so despite no La Nina, maybe the oceans have started to pick up a bit more (or expel less).
That is a record high daily average for Mauna Loa. They’ve had hourly averages higher but not daily’s.
This is the closet I can find to running data on volume
http://polarportal.dk/fileadmin/polarportal/sea/SICE_curve_extent_LA_EN_20170418.png
From here
http://polarportal.dk/en/havisen-i-arktis/nbsp/sea-ice-extent/
And here
http://polarportal.dk/en/havisen-i-arktis/
I’d guess that volume is now in seasonal decline.
Hi George,
From
https://www.esrl.noaa.gov/gmd/ccgg/trends/global.html
I found under further reading
http://www.nature.com/nature/journal/v488/n7409/full/nature11299.html
I only have access to the abstract not the whole paper, but from the abstract we have
Our mass balance analysis shows that net global carbon uptake has increased significantly by about 0.05 billion tonnes of carbon per year and that global carbon uptake doubled, from 2.4 ± 0.8 to 5.0 ± 0.9 billion tonnes per year, between 1960 and 2010.
Some might argue that recently there has been an increase in the rate of rise of global CO2, but this might be due to the recent strong El Nino. Using data from link below
ftp://aftp.cmdl.noaa.gov/products/trends/co2/co2_mm_gl.txt
found at https://www.esrl.noaa.gov/gmd/ccgg/trends/global.html
I created the chart below on the trend data, percentage annual increase in global atmospheric CO2 on left axis and the natural log of atmospheric CO2 divided by 278 ppm (pre-industrial Holocene average atmospheric CO2 level) on the right axis.
It’s spring in the northern hemisphere.
Do y-o-y changes depend on the season very much?
There is natural variability and the seasonal variability is slightly larger than the rate of increase.
The latest decadal rise is 2.4 ppm per year.
If a near 3 ppm rise is actually occurring it take a few years to actually be sure due to variations stated above.
Don’t be in such a hurry, doubling of CO2 will occur this century. Methane increases will make it nearly as dominant as CO2. Albedo changes are increasing heating and should soon be the dominant factor in global warming.
The fact that we can see major changes in just a few decades means the changes are happening over 100 times faster than normal increases in GHG and albedo.
I think the decreasing albedo is just gonna hammer us. Once the Arctic Ocean opens right up it’s gonna be some wild weather in the NH. Farmers should have fun with that.
http://e360.yale.edu/features/as_arctic_ocean_ice_disappears_global_climate_impacts_intensify_wadhams
Article says a 50% gain in heating from loss of Arctic ice and snow. Other scientists have been saying the Arctic changes will double the global heating.
Yeah and watch what happens to the permafrost on the Arctic landmasses and the Greenland Ice Sheet… we ain’t seen nothin’ yet!!!!
The core principle you climate change professionals seem unable/unwilling to comprehend is that our global climate is controlled by the clouds in the sky; greenhouse gases such as CO2 and CH4 are trace gases present in the atmosphere only in relative minute amounts. This means the fact of the matter is, they have surprisingly little to do with a destabilizing climate. Therefore, all this concern about their concentrations here, there, and everywhere is misguided angst, at best.
Let me explain the current science to you, demonstrated as in Arnold, 2006, among others. Once again, clouds are the driving principle behind global climate processes. Present understanding shows they are formed through upper atmosphere reactions influenced by CR (cosmic rays).
Furthermore to the point, the sun is also a major driver of earth’s climate; in the form of sunspots in particular. Sunspots generate a solar wind which disperses CR away from earth. Because, as previously discussed, CR influences cloud generation, it naturally follows that a decrease (increase) in the number of sunspots generated by the sun results in proportional increase (decrease) in the amount of observed clouds within the boundary layer on earth.
Hopefully you are still with me in understanding this complex science. If so, building upon the preceding discussion, more clouds within the boundary layer means a colder earth as diurnal surface temperatures are suppressed. Conversely, the opposite is also true; a lower amount of clouds means warmer surface temperatures. This is all due to the efficiency with which clouds block out the sun’s heat.
Now, to take this to a natural conclusion, low sunspot activity, such as we have seen within the present solar cycle, has profound consequences for global climate. The mechanism is thus: few sunspots means a calmer solar wind and increased CR, in turn causing more clouds here on earth.
Quite often in modern science Occam’s Razor applies; the simplest initial explanation is often the correct one. Much of modern climate science is designed to be a money-pushing affair, because the basic processes are already well enough understood.
Thanks Nicholas,
I feel so much better now. No need to worry about the hotter and hotter climate. Good.
How about soil erosion. We can just use sawdust to build up some more soil, right? Right!
Some people worry about running out of money. No need, just print some more. At home. Good.
Incidentally, whats your view on colonoscopies?
Thanks for coming out champ.
https://www.skepticalscience.com/solar-activity-sunspots-global-warming.htm
No wonder it’s so goddamn hot on the moon.
Not enough clouds.
I think your comments would be better directed at the authors and reviewers of the papers you disagree with. I’m sure they’ll treat your contributions with the respect they deserve, especially given your evident qualities of politeness, humility and openness to others viewpoints.
Which correlation seems more likely to explain the evolution of temperature?
Clearly its the sunspots! 🙂
Thanks for dropping in and setting us straight! Am I to take it then that that current increasing temperatures and all the melting going on are just a short term, temporary phenomenon? If so, does this mean that I should maybe stock up on blankets and sweaters for when the world returns to the long term cooling trend? Is it also an indication that the world is due for another ice age?
By the way, what’s your take on my post up top? What with China installing almost half of the amount of PV added globally last year and all. Do you think it has been a good idea for governments all over the developed world to let the “free market” decide what happens, when the Chinese government is obviously not playing by the same set of rules?
Crickets! Troll Alert! (5 questions, no response)
“Sunspots generate a solar wind which disperses CR away from earth. ”
Well, there ya go. If the solar wind decreases, so does the solar wind chill, which prolly makes the planet feel warmer. You should write it up and submit it to PNAS.
NS said “Once again, clouds are the driving principle behind global climate processes. Present understanding shows they are formed through upper atmosphere reactions influenced by CR (cosmic rays). ”
Clouds form in the lower atmosphere, not the upper atmosphere.
Hey NS, ever heard of condensation? The way clouds actually form is warm humid air rises from the heated ground region and cools as the altitude increases and pressure decreases. At some point the humidity goes above 100 percent and condensation occurs. Voila, clouds!
Easily observed and experienced. No sunspots or cosmic rays involved. Happens every day.
Other point is you neglect longwave infrared energy in your “assessment”. You also neglect albedo changes.
At the moment we are following RCP8.5 almost exactly. 2.4 ppm decadal average is slightly higher than the predicted increase for 2006 to 2016. RCP8.5 predicts doubling of CO2 by 2054, and of CO2e by 2045. Admittedly it seems unlikely this would happen as it would require a rate rise to 7 ppm per year, but who knows the way feedbacks are kicking in. Even at 2.4 ppm per year CO2 would hit 560 by 2080, CO2e probably 10 years earlier; RCP4.5 and RCP6 both indicate mid 2060’s for CO2e .
If I understand the recent papers correctly, and I probably don’t, then a doubling would give an equilibrium climate sensitivity of 4 to 4.5K, but an earth system sensitivity, i.e. including longer term albedo effects, full changes in vegetation cover etc. 50% higher at 6 to 6.75K. Some of the warming potential might be masked, if only temporarily, by aerosols and it would take a few hundred years for the full ESS effects to be seen, but overall that seems to me to indicate most of the earth and oceans would be uninhabitable for most life: ‘albedo effects’ is another way of saying 50m plus sea level rise, and that with ‘changes in vegetation cover’ actually means worldwide, multi-decadal famines.
It might be worse than that – the indications are that the sensitivity increases as the temperature rises (i.e. the interglacial sensitivity has been assessed at 4.35K compared to 3 in the glacial; we are going beyond a typical interglacial so the model results which include corrected cloud feedback and indicate 5 to 5.2K might be closer) and even if all fossil fuel use stopped the feedbacks from land use, permafrost melt, soil changes, maybe even hydrate release, would continue to release carbon. The way things have been accelerating maybe the hundred-year timescale would actually be significantly shorter.
On the mitigation side I guess if methane is a big component it would be quickly decaying. Also there is the question of wether we really have enough fossil fuels to get the rises indicated, and are unwilling to stop using them. The feedback changes with lower sink efficiencies and natural releases from soils and permafrost seem to reduce the amount needed with every new paper, but I think coal use (and available reserve) still seems key.
Hi George,
Do you think that much fossil fuel will be easy to extract and burn? You are very skeptical of even my medium URR scenario for oil (perhaps even the low scenario is too optimistic in your view). The high scenarios are roughly between RCP 4.5 and RCP6.0 as far as carbon emissions, and a scenario consistent with RCP8.5 over the long term would require a very unrealistic level of fossil fuel extraction, not very consistent with reality. My medium scenarios are roughly consistent with RCP4.5.
Also note that the high scenarios are most likely consistent with high fossil fuel prices as much of that resource will come from expensive EOR, deep water off shore, LTO, and extra heavy oil all of which are expensive.
Perhaps the high scenario for natural gas is possible, but coal is likely to be supplanted by natural gas, wind, solar, hydro and nuclear power as the resource depletes and becomes relatively expensive.
Chart below shows carbon emissions from my “high” scenarios for oil, coal, and natural gas compared with RCP4.5 and RCP8.5.
I did some rough and ready calculations (may be wrong).
By RCP8.5, 6 and 4.5 it looks like CO2 ppm of 500 to 520 is reached when CO2e is at 560. So assume an extra 100 ppm of net emissions. To get that would require burning 2.4 trillion barrels of oil (85 years at current production), 274 billion tonnes of coal (35 years) or 15 quadrillion cubic feet of gas (120 years) – or some combination. As only about half of the CO2 ends up in the atmosphere those numbers would be doubled. Burning all current oil and gas reserves would produce 55 ppm – I think less oil than predicted will be extracted, but possibly more gas. So the question would be whether there is enough from coal, changing sink efficiency and natural releases trapped, reduced carbon to provide another 45 ppm. It looks likely there will be. It seems unlikely to me that we are going to be able to come up with something to take CO2 out of the atmosphere on a big enough scale to make much difference. Although it can be removed OK the big energy and resource expense would be concentrating and sequestering it.
All that above assumes we don’t do anything to reduce fossil fuel consumption, which remains to be seen. But also there is a wide margin for scenarios between where we are and the catastrophic doubling, most of which is pretty bad for most of the world’s population.
Hi George,
Using the average carbon model from MAGICC 6 and the average CMIP3 AOGCM, 1180 Gt of total carbon emissions (560 Gt have been emitted already), peak atmospheric CO2 would be 510 ppm in 2080 to 2085 and then atmospheric carbon levels would gradually fall to 455 ppm by 2500.
Some of the scary scenarios are based on RCP8.5, which is highly unlikely, that scenario requires about 5000 Gt of carbon emissions and is at 2 times higher than any reasonable scenario. It is much more likely that we will see something like RCP4.5 at most (around 1500 Gt of carbon emissions), and probably somewhere between RCP2.6 and RCP4.5 ( call it RCP3.6 maybe) is probably realistic.
Hi George,
You are correct that through 2015 carbon emissions (including land use change) have followed the RCP8.5 scenario. After 2015 I expect carbon emissions will fall below the RCP8.5 scenario and by 2025 they are likely to peak.
Carbon emissions from
http://cdiac.ornl.gov/GCP/
RCP8.5 from MACICC at
http://www.magicc.org/
The climate sensitivity due to fast feedbacks (clouds, water vapor and sea ice and reduced snow cover extent) is about 3 C for a doubling of CO2, the effects of the changes in ice sheets, land cover and permafrost will add to that about 1 to 1.5 C. Note that the thermal inertia of the ocean causes the increase of 3 C to take about 400 years or more (globally) and the other changes possibly another 500 years, in the mean time carbon dioxide will fall somewhat from peak levels. A scenario I did using a Bern carbon model and 1120 Gt of carbon emissions peaks in 2083 at 510 ppm CO2 and then CO2 gradually falls to 458 ppm by 2500 and to 450 ppm by 5000 CE. If Earth system sensitivity is 4 C this implies about 3 C of warming above the pre-industrial Holocene average temperature.
Note that the temperature change from LGM to pre-industrial Holocene average was about 3.5 C which implies ESS of 5.5 C. Ice sheets were quite large during the LGM about 10 times larger than today in the Northern hemisphere. This might imply a lower ESS at present of about 3.25 C (rather than the 4 C estimate I gave earlier), in that case warming of 2.3 C is implied by my scenario (458 ppm in 2500 CE).
The science on this is not very clear. We should keep carbon emissions as low as possible in my view due to the uncertainty, we can always burn it later if needed (and if climate sensitivity ends up being lower than most scientists expect).
We will almost certainly exceed the RCP8.5 CO2 mid year number this year, but CH4 is likely lower, so CO2e is probably going to be about the same. I have no way at all of arguing with what you think the ESS or ECS or the other one (T something I think) is. I was just going on my interpretation of the recent papers, all of which indicate higher numbers than previously. Also I don’t think anyone knows really how much is going to come from the current dispersed sinks like soil and permafrost.
Seems I can’t edit this – I found some of the papers in full on-line for free, and a couple at the local library, but others only as abstracts and/or commentary. Some of the stuff is over my head. If you think I’ve interpreted any of them incorrectly let me know which, with a likn if possible.
Hi George,
Note that different papers arrive at different estimates. Most of the models that match well with the data have ECS around 2.7 C.
These models account for sea ice snow cover, but not ice sheets permafrost and land cover change in response to warming.
Those other feedbacks are less well understood, but push ESS higher by 1 to 2 C above ECS.
Post links to papers and I can read them.
Those without links give author and date.
Dennis – go here https://robertscribbler.com/2017/04/14/no-el-nino-but-march-of-2017-was-the-second-hottest-ever-recorded/#comments
look for comment by wili (I think his 3rd or 4th), it’s a copy of a list, with links, from another comment on a different blog:
“28 references [not including either von der Heydt et. al. 2016 nor Friedrich et al (2016)] that either directly, or indirectly, indicate that climate sensitivity is most likely significantly higher than the range summarized by AR5”
Yes I realise other research presents different numbers, part of why I presented my interpretation is because most of the new research differs on the high side, and fairly significantly with older stuff.
Hi George
You will need to copy and paste. The models from cmip3 withECS above 3 do poorly. In many cases the papers with higher sensitivity are measuring earth system sensitivity. ECS considers more short term changes over hundreds of years rather than thousands. Even the fast feedbacks operate over 400 years due to the thermal inertia of the ocean.
Hi George,
I agree we may remain close to RCP8.5 for 2016, or perhaps exceed it as far as atmospheric CO2 concentration. I doubt we will reach the 2025 level of 432.5 ppm for RCP8.5. For 2016 the average level was 402.87 ppm
ftp://aftp.cmdl.noaa.gov/products/trends/co2/co2_annmean_gl.txt
That would require a continued rise at 3.20 ppm per year for the next 9 years. I expect the price of fossil fuels will rise between 2017 and 2025 and the rate of increase in emissions will fall, the RCP4.5 scenario through 2030 is probably pretty reasonable, but from 2030 to 2060 carbon emissions are likely to fall much faster than that scenario as high fossil fuel prices lead to rapid transition away from fossil fuel use.
Hi George,
I think you would need to look at the full literature, for every person that pulls selected articles that point to ECS being higher than in AR5, another person can put up references that say the opposite. The IPCC report is a good middle ground. The evidence for this is there are a bunch of people claiming the IPCC estimates are too low and another group claiming they are too high. My guess is that they are probably about right. The nonlinear nature of ECS is well known. Much of the claims of higher sensitivity is a confusion between equilibrium climate sensitivity and earth system sensitivity. Also many papers use RCP8.5 as their starting point, as we will never see an RCP8.5 scenario (which would require no peak in fossil fuel output before 2100), those papers are best ignored in my view. Papers that consider more realistic scenarios like RCP4.5 are worth paying attention to.
Too many papers to read through them all.
Dennis,
The number of reputable, recent papers giving reduced estimates for climate sensitivity has been few to none that I’ve seen, and those sort of papers are easy to spot as they get jumped all over by the Daily Mail and blogs like WUWT (despite disparaging scientists for the rest of the time). There have been a couple of opinion pieces, such as on Judith Curry’s blog, and there have been some others that don’t have quite such an extreme increase (e.g. one recent one gave 2.9K as median, higher for mean, with 1.7 to 7.1K as the range – “Energy budget constraints on climate sensitivity in light of inconstant climate feedbacks” by K. Armour).
None of the papers listed make much reliance on the RCP. I think partly why the sensitivity numbers are useful is that the warming depends mostly on the total release not the rate, doubling is doubling. I looked at RCP’s only to get some idea of likely rates. The blogs that spend a lot of time concentrating on rate seem to think history stops at 2100, so as long as we’re OK then, nothing can possibly go wrong in afterwards, so no need for us to worry.
Hi George,
You said you read a bunch of papers and pointed me to a list with many papers.
Maybe you could point me to the two or three you find most convincing. Many on that list seemed to be papers talking more about earth system sensitivity. It will take 1000 years before we reach the point where those estimates are of interest. The papers I have read point to between 4 and 5 C for Earth system sensitivity for reasonable levels of carbon emissions (1000 to 1500 Gt of carbon emissions from 1750 to 2500 including land use change and cement).
The most recent models (CMIP5) also point to about 3 C for equilibrium climate sensitivity, earth system sensitivity is expected to be about 50% higher (4.5 C), though this estimate is less certain.
Note that less carbon emissions are definitely a good idea, the lower the better in my opinion.
I am trying to guard against the conclusion that we are screwed so we shouldn’t bother doing anything, essentially looking for a balanced realistic estimate.
http://www.bitsofscience.org/real-global-temperature-trend-forcers-climate-sensitivity-nasa-7046/
http://www.bitsofscience.org/real-global-temperature-trend-cloud-feedbacks-climate-sensitivity-7051/
http://www.nature.com/nature/journal/v505/n7481/full/nature12829.html
http://onlinelibrary.wiley.com/doi/10.1002/2016GL069243/full
Thanks George.
I will read and get back to you.
Note that the bits of science on a quick read of the first piece you listed gets a lot wrong.
For a view from experts I would consider better blogs like realclimate,org.
If you go to this piece (by one of the authors) you can find a link to the paper.
http://www.realclimate.org/index.php/archives/2016/01/marvel-et-al-2015-part-1-reconciling-estimates-of-climate-sensitivity/#ITEM-18951-0
I have read that paper it is very good.
In the piece at real climate by Gavin Schmidt (one of the premier climate scientists in my opinion.)
In particular, with the publication of Marvel et al (2015) (and also Shindell (2014)), the reason for the outlier results in Otto et al and similar papers has become much clearer. And once those reasons are taken into account, those results no longer look like such outliers – reaffirming the previous consensus and reinforcing the idea that there really is a best estimate for the sensitivity around 3ºC.
Real climate is a very good source for information about climate science by climate scientists.
The bits of science blog gets things wrong.
A discussion of the Sherwood paper at real climate (by Michal Mann and Gavin Schmidt) at link below
http://www.realclimate.org/index.php/archives/2014/01/a-bit-more-sensitive/#ITEM-16609-0
Also note that for the planet to get to 25 C would require quite a lot of atmospheric carbon dioxide.
A claim by authors that the PETM is a good analog for the Earth’s future is code for “the RCP8.5 scenario is a realistic future scenario”.
That is just not true.
The science blogs weren’t in the papers I originally linked – but they have discussion on things that are only available behind a paywall. The fact that some interpretation is wrong doesn’t mean it all is. Maybe go to the original Yale paper instead, or pick a different four. I find an argument, or rather an assertion, of dismissing RCP8.5 when that is what we are following at the moment not very convincing
Hi George,
RCP8.5 requires 5000 Gt of carbon emissions to be realized. For comparison my “high” fossil fuel scenarios result in about 1600 Gt of carbon emissions (fossil fuels cement, and land use change.)
The RCP8.5 scenario has about 12 Gt of carbon emissions in 2020 (which I agree may be reasonable) and 28 Gt of carbon emissions in 2100 (almost 3 times current levels).
If you think that is a reasonable scenario, I guess you believe a peak in fossil fuel output is unlikely before 2100.
I disagree strongly with that position.
Oh and do you believe that Gavin Schmidt is interpreting the paper he was a co-author on incorrectly?
I do not have access to the paper on the PETM, but would assert that the planet was quite a bit different then than now (younger Sun with lower output and land masses in different positions).
I am not too convinced that we have good estimates of the atmospheric composition during the PETM so not a lot can really be learned about climate sensitivity looking that far back in time.
blog post I found on that deep time paper
http://www.reportingclimatescience.com/2016/06/29/paleo-climate-sensitivity/
also this press release from the university where the researchers work.
http://www.nbi.ku.dk/english/news/news16/warning-from-the-past-future-global-warming-could-be-even-warmer/
Our results show that the amount of carbon that drove the PETM warming was about the same amount as the current ‘easily accessible’ fossil fuel reserves of about 4,000 billion tons.
These researchers are wrong on the amount of “easily accessible” fossil fuel resources.
I found this interesting.
https://tamino.wordpress.com/2012/06/01/annual-cycle-of-co2/
From what I understand the y-o-y changes are impacted most by location.
Looks like some tie dye. Got an animated version I can appreciate also? ????
My dog is smarter than your dog!
.
Doge, decline-mode…
Troubled times in Venezuela.
http://imgur.com/a/uyDQk
Paradoxically, Venezuela’s a paradise, as is the rest of the planet.
The ‘troubled times’ are ‘just’ an outward expression of what’s ‘inside’. Initial conditions. Call it ‘the economy’ if you wish, until it isn’t, if it ever was.
“…Are the shelves bare yet where you are? Hungry? Don’t know how to grow your own food or where or how to find it? Oh you do? But there are other hungry people running around who don’t? But you own an EV? That’s nice. May I sleep in it too?”
I was passing by a military barracks the other day and thought to myself how the military are paid by the money stolen from the populations to defend the populations (so the propaganda goes), but when the SHTF, those dubious initial conditions can express themselves quite differently, such as when conditions change and the stolen pay gets more difficult to extract.
Many don’t think of that.
Same thing with the police. Say, ‘police state’ to yourself and see how it sits with you.
One day, you’re getting a traffic ticket with a friendly smile, and the next, you’re their donut, or more so, since you may already be paying for theirs…
Fair warning.
…
First big time wind project in North Carolina is now operational.
http://www.charlotteobserver.com/news/local/article131684094.html
Putin-linked think tank drew up plan to sway 2016 U.S. election – documents
http://mobile.reuters.com/article/idUSKBN17L2N3?utm_content=bufferb4c03&utm_medium=social&utm_source=twitter.com&utm_campaign=buffer
Thanks to the Dunning–Kruger Party.
Permafrost thaw threatens flood of carbon, methane emissions
http://www.theecologist.org/News/news_round_up/2988857/permafrost_thaw_threatens_flood_of_carbon_methane_emissions.html
so earth is getting ready to take a giant poopie? 😉
Gift idea for your local climate scientist. ???
Take a moment or three to dive into the contemporary literature on this matter. Scientists regularly publish reports and stories about new research or understandings, and you can utilize a service such as Google Scholar to monitor their work output; no need to rely on these third-party retelling websites like the ones frequently linked here. The problem with those, you remember how that old childhood game of telephone goes? The more a story gets retold, the less close and truthful it is to the original telling. Plus, within multiple retellings of something, people can start to insert their own biases and agendas.
Anyway, the current understanding about CR (cosmic rays) and clouds is thus: CD drives the formation of CCN (cloud condensation nuclei) which are the building blocks of clouds. The remainder of the process I already explained in my previous reply.
Note to all: This reply was in reply to a response by Doug Leighton which appears to have now been deleted.
https://youtu.be/9a3eCHij4Vo
http://link.springer.com/article/10.1007/s11214-006-9055-4
Might present some difficulty for a self-proclaimed genius to understand, though.
Yes thank you for the link. However, I was referring to your Moronish comment about equating the publication of scientific news stories with the childhood game of telephone.
“The more a story gets retold, the less close and truthful it is to the original telling.”
You’re definitely special. Thanks for coming out champ.
We’re all special, bro. If Barney says so that’s good enough for me.??❤️???
Your explanation fails when exposed to data:
Facts are a liberal plot to raise taxes, destroy capitalism, and create a one world government.
Don’t you know the truth?
Israel-Gate
https://consortiumnews.com/2017/04/20/why-not-a-probe-of-israel-gate/
Because the Israelis are always the Good Guys ™.
Just like the US military NEVER commits war crimes and the Russians are ALWAYS to blame for anything.
Areas near the Bering Strait already seeing quite a bit of open water.
https://seaice.uni-bremen.de/sea-ice-concentration/
http://www.bizjournals.com/charlotte/news/2017/04/20/viewpoint-duke-out-of-step-with-public-on-solar.html
NC is now rolling in a big way in the solar power category, even as DUKE does everything possible to slow the progress of the wind and solar industries, while advertising buying and investing in renewables in an effort to fool the public.
Red NC people support renewable energy, and are happy to see wind and solar farms built in their state, providing employment and tax revenues.
Renewable energy and a clean environment need not be partisan issues. There’s NOTHING that leftish liberalish leaning people can do to change the rhetoric coming out of the R / Koch camp , but there IS something they can do to promote the growth of renewables , and preserve the environment.
They could quit shooting off their feet by continuously making smart ass condescending remarks that have the effect of driving rightish leaning voters and potential voters into the big R camp.
You can take it to the bank that they hear every thing you have to say about them, because the media they read pick it up and repeat it.
Hi OldMacDonald aka KGB Trumpster
Mac,
I very strongly agree – we should show respect for each other.
Now…is there any question that Rupert Murdoch controlled media, and other such media, show great disrespect for the people they define as the enemy, and *greatly* exaggerate (or invent from whole cloth) the disrespect shown BY the “enemy”? Think of Bill O’Reilly, and his “patriots” vs “pinheads”, and much, much worse?
Is there any question that such media is fanning the flames of conflict? Hate, fear and disrespect-mongering?
Hi Nick,
Of course the Fox types in the media do everything they can to fan the flames, and confuse the issues, to the end of furthering the agendas of the people who own right wing media, or pay for advertisements there.
All use of the word “you” is rhetorical in this comment.
That works for THEM, because so many people are already pissed about the cultural portion of the liberal agenda, and are prone to oppose the environmental portion of it as well, out of cultural tribal loyalty. It works because most of the independent and right wing types who are opposed to renewable energy don’t actually know and understand the actual big picture facts involved.
BUT it doesn’t work well at all from the leftish leaning end of the political spectrum, because the folks on the leftish liberalish wing are pretty much IN THE BAG, they are more or less already committed to environmentally sound values, and there is NO NEED to mislead and manipulate them in order to keep them showing up on election day.
A simple example is that gays and lesbians don’t need to be fed a stream of vile remarks about low life right wingers to keep them motivated to show up and vote D. They already KNOW, they are ALREADY motivated.
So -What I am saying is that as a PRACTICAL matter, when the goal is regaining control of the government by the D party, so as to enact and enforce sound environmental laws and policies, one of the WORST things environmental advocates, unfortunately including some of the members of this forum, can do is bad mouth working class and conservative and religious culture and values. This drives potential D voters by the millions into the opposition camp, while bringing potential voters into the environmental camp in relatively small numbers, if indeed it brings in ANY new D voters. Folks who look down on right wingers already strongly motivated to vote D anyway, and they likely to already know enough about environmental issues to know what is in their own enlightened self interest.
The typical right winger working class type potential voter is , relative to the typical D voter, seriously ill informed when it comes to the BIG PICTURE in respect to wind and solar power, electric cars, the need for strong environmental protections, etc.
IF you want his vote, you have to first talk to and about him respectfully, so that he is willing to at least listen to what you have to say. Once you have his attention, then the best path forward is to minimize talk about the climate, and maximize the talk about the aspects of renewable energy that are consistent with his own values, which will given time result in his becoming a renewable energy advocate.
LOCAL CONTROL of important issues is extremely important to culturally conservative and working class people, and knowing their electricity is produced locally, rather than in another state pleases them mightily . Tax revenue generated on local investments pleases them mightily. Local jobs please them mightily.
And while the typical better educated and well informed person doesn’t really ever think much about inflation, I guarantee fucking tee ya that inflation is hot button that works extremely well when talking to working class and conservative people, because they see their incomes stagnant while their living costs are going up. It’s ok to argue that gasoline is cheap, historically, when talking to somebody making fifty or sixty thousand bucks or more, because they can still buy a tank full, or two tanks full, for an hours wages. Folks who are falling behind remember when gasoline was cheaper, rent was cheaper, groceries were cheaper, etc, in RELATION TO THEIR CURRENT INCOMES.
Such people are quite willing to believe ( and in my opinion they will turn out to be correct in this belief ) that the prices of coal, oil, and natural gas will continue to go UP, long term, and that having wind and solar power available will turn out to be cheaper for them, long term, especially considering the local benefits of employment and tax revenue for the locality.
Such people very seldom ever have a positive opinion of big businesses of any sort, and they are quite ready ( justifiably ) to believe that big businesses are out to screw them to the extent possible, in terms of delivering the least for the most money, so they are predisposed to stick it to the electric utility by advocating putting renewable juice on the grid.
They are as a rule NOT opposed to the sight of windmills or solar farms, because they believe that it’s the right of property owners to do pretty much as they please, so long as they don’t harm their neighbors to any serious extent, but they might need a gentle and subtle reminder of this core conservative belief once in a while, in a public discussion.
You don’t win a rural or small town working guy over to being a strong advocate of clean water laws by attacking businesses that provide jobs and essential goods and services DIRECTLY.
You talk about fishing in the nearby rivers and lakes, and paying extra for cleaning up the water that his kids drink, and how it ain’t right that people up stream dump shit and piss and poisons of various sorts in the river passing thru or near his home turf.
If you are reasonably skillful, you will soon have him repeating that old saying about the other fella’s right to wave around his fist stops short of HIS OWN nose.
Enlightenment and wisdom come a little at a time.
You can’t do much, if anything, to control the rhetoric of the opposition, or to control who the opposition nominates to run for office, but you CAN control your own party and coalition, to some extent at least.
Blaming Trumpster for Clinton losing is a straw man argument. Every little kid, and every ball team composed of little kids , blames bad luck, or bad referees, or something, for losing. As the kids get older, and wiser, they come to understand that they win or lose depending on how well THEY perform. THEY can do better, but they cannot control how well the other team does.
“LOCAL CONTROL of important issues is extremely important to culturally conservative and working class people, and knowing their electricity is produced locally, rather than in another state pleases them mightily . Tax revenue generated on local investments pleases them mightily. Local jobs please them mightily. ”
Yes, I know the type well. Saw large tracts of the last semi-wilderness in a beautiful region come under local control, to be stripped of vegetation and made into large industrial parks in the name of a few local jobs. Local resident’s land that was idle ( interpret as natural) was forcibly appropriated by local government for jobs and schools. Didn’t matter that the region was the source aquifer for much of the region or that the altitude made it vulnerable to stress. The pristine wild creek in the area now had industrial and government processed sewage and drain water pumped into it. Just can’t leave anything alone, they took what they could and wrecked, now they have a Wal-Mart distribution center and a few other warehouse type businesses. Trucks rumble into and out of an area that had once been wooded and edged several natural lakes and ponds. Guess where the pollution goes.
There was plenty of development and business not many miles away, but the last large jewel of nature in the region got in the sights of the local politician types to make a name for themselves. Know them well. Will never set foot in their houses even though I have been invited.
I wonder if any of the locals even got hired there.
there is NO NEED to mislead and manipulate them in order to keep them showing up on election day.
If only that were true. Wasn’t greater turnout by conservatives a key element of this election, leading to almost all of the polls being wrong? If more women and young people had shown up, the election would have been different.
IF you want his vote, you have to first talk to and about him respectfully
Yeah. It’s worth saying again – I agree with you, respect and listening to each individual’s concerns is important in communication and persuasion.
Blaming Trumpster for Clinton losing is a straw man argument.
I disagree strongly. First, a trivial quibble: a straw man argument is one that isn’t realistic, which isn’t really being presented by the party being discussed, and which is easily falsified because…it’s a bad, unrealistic argument to start with. That doesn’t apply here – lots of people are indeed arguing that Trump actually had something to do with the election.
2nd, as it happens..I’m not making that argument. I’m arguing that dishonest media had enormous impact. That’s different, and I think it’s clearly true.
3rd, this isn’t baseball. Basic analysis is more important than developing short term tactics and strategy, which is why I’m not primarily concerned with political party tactics. I think it’s more important to have a realistic overall idea of what’s really happening in the world. Knowledge is power. If you don’t understand the basic dynamics shaping people’s ideas, you’re in trouble. In this case, if you don’t understand that people’s ideas are flying out the TV/radio speakers, into people’s ears, and then directly out of their mouth without editing….you’re handicapped.
I don’t think you’ve quite appreciated how much influence conservative media has had in the last several decades. In particular, the perceptions on that part of conservatives that “liberal media and intellectuals” are being disrespectful, that government is bad, that local control is better…these are propaganda memes, and were mostly (not all, certainly, but mostly) created by media at the behest of their Murdoch/Koch masters who know that democracy (including independent media and national government) is their enemy.
It’s a fundamental attack on democracy. That’s important to know.
All the polls and all the statistics will not matter when Duke drops a large bribe, errrr, I mean campaign contribution into the right* hands.
NAOM
*Correct not political right… of course!
http://www.nbcnews.com/news/us-news/dow-chemical-pushes-white-house-kill-risk-study-showing-pesticide-n749396
Unfortunately bribery works all too well.
But in the case of renewable energy and the people of North Carolina, I have some hope that they will continue to support renewables in a big way, and that this support will be adequate to force their state government to support renewables as well.
Now about pesticides, any argument about farmers HAVING to have a given pesticide is a straw man argument, long term, although it is reasonable to phase out a problem pesticide over a few years if a substitute is not yet available, or the evidence is not clear and compelling in respect to the problem.
As a working farmer and businessman, I passed my costs along. Farmers always pass along their costs. There isn’t any such thing as a pesticide we can’t get along without, generally speaking. If we can’t use any certain one, our yields may go down, and our other expenses may go up, but in the end……….. we pass our costs along, and consumers pay those costs.
We can do a LOT better job regulating the use of pesticides than we have done in the past, but we CANNOT survive without pesticides now, or for the foreseeable future.
CLIMATE CHANGE AND RISK TO FOSSIL FUEL INDUSTRY: SUSTAINABILITY TRAIN HAS LEFT THE STATION
Two seminal articles by energy experts in the latest issue of MRS Energy and Sustainability (MRS E&S) examine the climate-related risks facing the fossil fuel industry and conclude that the sustainability train has already well and truly left the station — and is not coming back.
The former Associated Press Gulf correspondent finds, however, that climate changes risks vary according to different sectors of the energy industry. Demand for oil seems to be insulated from the very immediate risks facing other sectors of the industry, due to its unique role in transportation and the lack of viable alternatives, he writes. Citing a study by McGlade and Ekins, he concludes that oil reserves are the least exposed of the three fuels. Just a third of current conventional crude oil reserves would probably be abandoned to meet current global climate change targets, as opposed to half of gas and 82% of coal reserves.
https://www.sciencedaily.com/releases/2017/04/170418160036.htm
Meanwhile,
CLIMATE SCIENCE BEDEVILED BY ‘TIPPING POINTS’
“We don’t know exactly when we might pass these points or whether we already have crossed some of them…The problem is that there is no perfect analogue to what we will experience in the near future. Concentrations of CO2 in the atmosphere today are higher than any time in the last three million years, and are increasing more rapidly than at any point in the last 66 million years.”
https://phys.org/news/2017-01-climate-science-bedeviled.html
I sometimes think that mental avoidance is a large issue concerning global warming, both anthropogenic and natural. People just do not want to hear or contemplate the changes coming even in the fairly near future.
Humans are saddled with other shortcomings, too. “Loss aversion” means we’re more afraid of losing what we want in the short-term than surmounting obstacles in the distance. Our built-in “optimism bias” irrationally projects sunny days ahead in spite of evidence to the contrary. To compound all that, we tend to seek out information not for the sake of gaining knowledge for its own sake, but to support our already-established viewpoints.
https://www.theguardian.com/sustainable-business/2014/nov/10/brain-climate-change-science-psychology-environment-elections
Nick Schroeder – a little homework for you that perhaps could assist us in improving our climate models.
Below is a link to the brief 600-page “Clouds and Aerosols” chapter from the IPCC’s 5th assessment report on Climate Change. Could you read through it, double-check the models, and help us find out where the heck we went wrong? We – and the world – would be forever in your debt.
http://www.ipcc.ch/pdf/assessment-report/ar5/wg1/WG1AR5_Chapter07_FINAL.pdf
The IPCC assessments are utter failures, if not outright frauds, considering the UN in 2015 had to admit we were on year 17 and counting of absolutely no observed increase in global temperature. Now I may not be an Oxbridge bloke, but if the climate scientists have no warming, they have no valid theory. That’s quite simple to understand.
That is an attempt at a logical fallacy called, I expect by Oxbridge blokes but others as well, proof by repeated assertion, sometimes argumentum ad nauseam – i.e. just keep repeating a falsehood until others give up bothering to reply, often the more stupid the statement the quicker others give up, and then you convince yourself you had some brilliant insight that makes you right.
All but number 8 of the top ten years for highest temperatures have been this century. The top three, in reverse order are 2014, 2015, and 2016. The temperature increase has been accelerating. This year is likely to set a new record at current pace. Try googling “hottest years on record”, I got over 4 million results, the first few pages all seemed to have a year from this century in the title.
https://youtu.be/hS1okqbnePQ
LOL! No worries. There is no danger of you ever being mistaken for an Oxbridge bloke. You are either an ignorant or paid troll who is a bald faced liar, full of shit and a fucking idiot to boot! Oh, and you also have your head up your ass! Bet you wouldn’t even know how to convert fahrenheit to centigrade if your life depended on it, let alone solve the simplest of differential equation used in climate modeling. The debate in climate science is no longer about change, that has been firmly established since the late 19th century. Today it’s about the consequences of the accelerating rates of change in multiple linked non linear systems. You are a prime example of extreme Dunning Kruger syndrome.
There’s a reason (pun intended) that scientists are marching today in Washington and cities all over this country and the world.
http://www.vox.com/science-and-health/2017/4/19/14331168/science-march-earth-day-route-livestream-signs-speakers
A little warm?
https://uploads.disquscdn.com/images/cc42a72a9a3f2feb4f000d71664c756c55f7d02858b77829c2ddba22a63e950b.jpg?w=800&h=452
For me, Kermit died with Henson.
The Collapse of Western Civilization: A View from the Future
The year is 2393, and the world is almost unrecognizable. Clear warnings of climate catastrophe went ignored for decades, leading to soaring temperatures, rising sea levels, widespread drought and―finally―the disaster now known as the Great Collapse of 2093, when the disintegration of the West Antarctica Ice Sheet led to mass migration and a complete reshuffling of the global order. Writing from the Second People’s Republic of China on the 300th anniversary of the Great Collapse, a senior scholar presents a gripping and deeply disturbing account of how the children of the Enlightenment―the political and economic elites of the so-called advanced industrial societies―failed to act, and so brought about the collapse of Western civilization.
https://www.amazon.com/gp/product/023116954X/ref=pe_2511300_235415610_em_1p_1_ti
Hi HB,
Are you investing the profits from your investments in oil in retirement home someplace well up on a mountain at least a thousand miles or more NORTH of Huntington Beach ?
If you aren’t old already, you might give this some thought.
I remember you bragging about stupid Republicans making a lot of money for you , by way of using oil.
Well hi Trumpster, thank you for asking about my well being. Got a late start this morning. First thing, made it to the gym. Got 4 boxes of old business files shredded for free. Checked in on my 90 year old mother twice and had dinner with her. And this afternoon got in a nice 25 mile ride for my cardio. Beautiful sunny day in the upper 70’s. How are you ? I hope your doing well(now start voting Democrat you idiot).
Funny that you ask about a retirement home. Because that’s the second time today the subject has come up. But it wasn’t because my current home is going to be underwater soon. When I bought the home 34 years ago, to get a mortgage it was required by Federal law that you had to have flood insurance. Almost 20 years ago, the army corps of engineers came in and spent millions of your tax dollars to rise the flood channel walls about 2 or 3 feet higher. Thank you by the way. In the mid 90’s from an El Nino winter storm, the channel over flowed and flooded the near by mobile home park in the low lying area. The elevation of the slab floor in my home is exactly 10′ above sea level(per county records). I believe the area is now rated to with stand a once in a 500 years storm. But, if the big pond out there called the Pacific rises a couple of feet and off sets your tax dollar improvement. Then we’re talking it’s just a matter of when.
Now back in 2005 I purchased all most a half acre lot on Lake Hartwell in South Carolina to build a second home and then to maybe retirer there. It’s a beautiful lake and area. But before I ever broke ground. Your southern ways turned me off and today I just want to sell the lot to get out from underneath it. That’s about 200k of new home construction jobs that didn’t happen. But that’s not my problem. I didn’t realize at the time, you guys are still fighting the civil war. That mistake is going to cost me some money by the time I unload that property.
Now most of my oil portfolio is in refineries. After the crash of oil prices two years ago. I’ve been picking up some producers, but I’m still mostly refiners. I have moved from pretty much a fully invested position prior to the election. To about 10% cash today. I think this current economic cycle is getting long in the tooth. The Trump rally is pretty much over and expect a major pull back/chance of recession in the near future(1 or 2 years). I’m hoping the refiners make another rally going into this summer and I’m able to unload about a third of what I have left. My cost basis is so low on the rest of the refiner stocks I own, I don’t want to pay the long term gains taxes now. Plus I also want to increase my cash position to closer to 20% and just wait for the Trump market collapse.
So baby dog, what did you do today ?
Hi HB,
Yesterday was not the best of days here,weatherwise, it poured almost all day like the proverbial cow peeing on a flat rock. So I spent almost the entire day inside with my ninety plus Dad, reading some Faulkner, cruising the news, talking to old friends on the phone, working on my book. Today if the weather clears, I will enjoy a four or five hour hike taking me into the national park which is only half a mile away as the crow flies, looking for morelles.
I made breakfast for Daddy, changed his bed, helped him bathe, and will be back in the house to fix lunch for him, and dinner as well, and do whatever else is necessary to his welfare. I hire a cleaner once a week but other than that, I’m personally doing what he did for his parents, and what they did for theirs before them, honoring my father and my mother.
If it is within my power to prevent it, he will never suffer the indignity and pain of being taken out of his life long home and put in a ROOM in a nursing home among strangers. We have a million dollar view from the sunroom, which is where he spends almost all his waking hours, and right now, this very minute, there are goldfinches and blue jays on the bird feeders and a whitetail doe and her fawn at the far edge of the lawn, a couple of hundred feet away, enjoying the salt block I put there so as to entice them to show up more often than otherwise. The first humming bird showed up a couple of days ago.
I’m an atheist, or technically an agnostic, but I take the moral teachings of the Christian church very seriously indeed, and put quite a bit of time into local charity work, for instance harvesting and delivering firewood to an old woman who lives half a mile down the road and really needs all the help she can get.
This way I’m getting a three for one, doing a good deed, getting some exercise, and clearing and landscaping some overgrown hill top ground with a view which I will eventually sell to a rich yankee, assuming it doesn’t get so hot they quit moving down this way. I would rather see this community stay the way it was when I grew up, populated only by locals, mostly farmers, with houses few and far between, but I can’t stop the development, and the development puts me in a position of paying outrageous property taxes , so I find it expedient to sell an acre every once in a while to cover the taxes.
My next recreational exercise will probably be hiking and trout fishing in the stream that passes thru my farm. I own half a mile of it, to the extent anybody owns a stream, and I have permission to fish upstream all the way to the point it gets too small, and down stream farther than I can walk and back in a day.
My biggest on going project, other than the book, is an acre plus private lake which I am constructing personally, doing the entire job myself, exclusive of the required soil inspections. I don’t have the license necessary for that, but the engineer who did the inspection knows less about soils than I do, and admitted as much. I guess it’s sort of redneck of me, but I enjoy running big yellow construction machinery so much I have my own, lol.
It won’t generate any cash income, but a good friend who is a local real estate agent tells me the lake will add fifty thousand bucks to the price of my place if I decide to sell. So in effect this means I will earn about forty thousand bucks tax free in equity, because I’m spending ten. If I were to stay on the job eight hours a day, I would be finished in a couple of months. That’s not enough to brag about, maybe, but it’s enough to satisfy ME.
The lake will provide recreation and fish for the table for a thousand years to come, if future owners maintain it properly. It will have to be drained and the accumulated sediments removed once or twice per century, otherwise it will turn into a small wetland, which would be perfectly ok, other than the loss of the fish and swimming.
Thanks for telling us again how well you are doing in the oil biz, while posing as an environmentally concerned citizen, and thus indicating how you don’t have to actually work for a living, as opposed to just managing your investments, which doesn’t normally consume a hell of a lot of time unless you are really rich.
I have taken note of the fact you are obviously very much in favor of regressive tax law, which will allow you to rake in a substantial profit at a lower rate than clerks and cops and carpenters pay, on much less money. You’re proud of sharing that tax privileged status with Warren Buffet, who so I hear has said he pays less , percentage wise, than his secretary, lol.
Sounds sort of Trumpsterish to me, other folks mileage may vary.
Sounds sort of HRC ish to me. She made a habit of hanging out with rich people, and looking down her nose at those of us who are less fortunate, while arrogantly assuming the peasants/ foot soldiers of the REAL Democratic Party would continue to vote for the D party based on the fact that it USED to be THEIR party. That mistake was one ( of many) that was in and of itself enough to cost her the presidency, considering it came down to the last three Rust Belt states that put Trump in the WH. If she had had sense enough to campaign like she meant it among the real core of the D party, instead of aligning herself with the D elite, sho would have won.
Oh, I forgot, an hour of the phone time yesterday was with a young lesbian couple talking politics. We will probably be working a phone bank together next election cycle, supporting Sanders style Democrats, REAL Democrats, organizing transportation to the polls, getting likely D voters registered .
Ninety percent of everything I do will leave the local environment in better shape for generations to come. I plant long lived fruit and nut trees. I manage the land that’s cropped so that the depth and fertility of the soil is increasing. I deliberately create small patches of wildlife habitat designed to provide food, cover, and breeding needs of local and migrating species.
Time and energy permitting, I will build a micro hydro plant of my own, maybe this year, that will provide a couple of thousand watts continuously,
in order to reduce my grid sourced consumption. I’ve already built a solar domestic hot water system that works like a charm. Solar electricity is on the to do list, but I have been putting it off since the price of it is declining so fast it’s a dollars and cents no brainer to put the money into other projects for now.
Given that you have a ninety year old mother, it seems likely old age will get you before the climate goes seriously haywire, so you won’t be NEEDING a home up north.
I salute you for being a caring son. Altogether too many people don’t really give a damn anymore about anybody but themselves.
“Thanks for telling us again how well you are doing in the oil biz, while posing as an environmentally concerned citizen, and thus indicating how you don’t have to actually work for a living, as opposed to just managing your investments, which doesn’t normally consume a hell of a lot of time unless you are really rich.
I have taken note of the fact you are obviously very much in favor of regressive tax law, which will allow you to rake in a substantial profit at a lower rate than clerks and cops and carpenters pay, on much less money. You’re proud of sharing that tax privileged status with Warren Buffet, who so I hear has said he pays less , percentage wise, than his secretary, lol.”
If you want respect, than you need to learn how to show it and earn it. No body gave me anything. I started at the age of 14 cleaning back inside window at a car wash for $1.35 an hour. By 16, I bought my own clothes and any food outside my parents home. I paid for my own colleges expenses and saved up for the down payment all by myself for my first home. I came from the school of hard knots.
I’m a proud Environmental Democrat and I believe in a progressive tax system. Your a admitted Independent living with daddy. Don’t tell me what a real Democrat is. You wasted your vote on Jill Stein.
LOL! This one was written specifically for Caelan.
https://xkcd.com/1823/
Don’t forget to hover your mouse over the comic for the punchline…
Thanks Fred! I used vi (vim) from 1995 until I retired in 2015. Great editor. Don’t get me started on Word…
Abandonworld
There’s this software– ‘abandonware’ I guess– called Mojoworld…
It is sort of a semi-automatic landscape modeling software that’s apparently accurate to scale, unlike, at the time it was being developed, some or perhaps much of the landscape generation software at the time.
The person– Doc Mojo?– who created the software has or had a nature/landscape photography hobby apparently, and I had wondered if he had some kind of epiphany and/or sudden internal conflict about mimicking landscapes inside of a computer, when there was all this beautiful landscape already all around him (that he was, if he was, mind you, ‘encoding’ onto some sort of ‘substrate’, if that’s the right word)…
Perhaps it’s a bit like climate; modeling the (
destruction) changes of what we are (destroying) changing… while on the ‘other side’ bean-counts of fossil fuel depletion continue…Anyway, looking at some of these Mojoworlds that users have/had created made me think of them in relation to the immediately pre-human landscapes– ‘Eden’ if you will– and in relation to the current ones, and then in relation to other software that took two or more images and interpolated between them…
It seems like our relation to the planet is kind of like some sort of hybrid between the Mojoworld landscapes inside the computer and the real landscapes that currently have our handwriting all over them. IOW perhaps, we seem kind of trapped in an interpolative pseudoland between artificial reality and real reality.
We don’t seem to have a full handle on either. Maybe we never will, maybe because we are not approaching either fully, and probably cannot– it’s physically impossible, since we exist in reality, if also within our minds, if also within our computers (technological constructs).
Some of this is also a bit like typing this on ‘the computer’ to ‘Peak Oil Barrel’ and then going to and meeting and speaking with a friend at a cafe. Mind you, interacting at the cafe under a crony-capitalist plutarchy money-profit context, where one almost has to buy stuff if they want to socially interact, has its own can of worms, but we won’t open that today.
Fred Magyar, for example, from my vantage-point is, maybe, ‘metareal’. IOW, this ‘Fred Magyar’ could be more of a ‘substrate encode’ or, say, a ‘media encode’ ‘than anything else’…
…subject to my own potential edits… that others then may read… reinterpret and then edit again… etc….
“It’s too bad she won’t live. But then again who does?” ~ Bladerunner
The general human relationship to the natural world is destructive war. Even the educated, though they go to great lengths to justify it, still proceed with the battles.
https://www.youtube.com/watch?v=474QL5NGgic&t=2396s
Fred Magyar, for example, from my vantage-point is, maybe, ‘metareal’. IOW, this ‘Fred Magyar’ could be more of a ‘substrate encode’ or, say, a ‘media encode’ ‘than anything else’…
I’m just a virtual reincarnation of the original Max Headroom…
1980’s Some of the best max headroom quotes (from the 80’s man)
https://www.youtube.com/watch?v=nt56RMbpq_0&list=RDnt56RMbpq_0#t=5
Back then I was writing code to create Mandelbrot sets and dropping Acid to expand my consciousness. Twas before your time…
.
Maude: What do you do for recreation?
The Dude: Oh, the usual. I bowl. Drive around. The occasional acid flashback.
~Big Lebowski
Beatniks and Civil Rights- The Warlocks https://www.youtube.com/watch?v=W7TYQf-qOGs
An entire day without coal-generated electricity in the UK…first time since sometime way back in the industrial revolution’s beginnings.
http://www.iflscience.com/environment/uk-heading-for-first-coalfree-day-since-the-industrial-revolution/
The U.S. is being left behind…we must cater to our rube idiocracy and listen to the supreme clown-in-chief’s tweets!
Placards seen at the scientist’s march in Washington…
“What do atoms and Trump have in common?
They both make up everything…”
“If you are not part of the solution you are part of the precipitate”
Many more gems were found there!
I think that Trump is a magnet for attention. One of the things I learned early was to not get fixated on the obvious, to look around in all directions since it is the quiet danger that gets you.
We need to be watching the quieter ones in Congress and in business. The obvious ones are watched closely. The noisy flamboyant ones are often mostly distractions.
Greenland ice cap is often in the news with melt ponds and cracks forming. With much of the ice cap over a mile high, the lapse rate of -0.71 C per 100 meter helps to keep the top of the ice cap cold. Despite that, melting is occurring along the more southern and western portions of the ice cap. A rare warming event as happened in 2012 can cause melting across the whole ice cap surface.
But the lapse rate operates in both directions. As melting causes a lowering of the ice cap, it will get 0.71 C warmer per 100 meter loss. Add to the that the effect of global warming this century will have the effect of moving the ice cap about seven degrees south. The altitude factor is a definite positive feedback which will accelerate melting with time.
The negative feedback factor is that Greenland will rise as the ice departs. Since most of the ice was lost during the Eemian, I expect that land rise is not much of a factor. So we have a fast feedback system to reduce ice in the Greenland ice sheet.
I was wondering what the actual energy to melt the Greenland ice cap would be and if it would have a significant cooling effect. So I compared it to the ocean heat rise equivalent. The amount of heat energy needed to melt the Greenland ice cap is equivalent to reducing the first 300 feet of ocean water by 0.1794 degrees F.
So as far as keeping the earth cool by meltwater, not going to happen especially since it will take many years to melt.
Greenland probably does a better job cooling the earth through the altitude of the ice cap and it’s high reflectivity. Once the ice is reduced in area and altitude, the cooling effect of Greenland will be vastly reduced and just that energy change will provide more than enough energy to melt the rest without any temperature change to the ROW. In fact Greenland will become a source of heating energy rather than the cooling system it is now.
Climate change is real!
.
Attended a march in Bend Oregon, that was well attended, but little response from the proletariat that was driving F350’s.
Maybe humans are just not smart enough?
The lead-poisoned humans certainly aren’t smart enough.
But since non-lead-poisoned humans are the ones who pushed lead poisoning on all of us…
Do not confuse intelligence with focus. Many of those people are very smart, they just focus on other things, often practical and realistic things.
Show them the money, the economic advantage, in a realistic fashion and they will make it part of their reality. Just don’t expect it overnight. People need to get past their habits and egos by coming up with the ideas themselves. You just plant the seeds.
They say the rise of the Himalayas changed the global climate. What will they say when a giant plateau more than a mile high and twice the area of the Himalayas disappears?
We’ll deal with it just like any other adversity faced in world history. Look at it this way, there are likely to be quite a few good things that come from continued warming of the planet. Besides, whether the warming is partially due to some human activities or all natural, you have to admit trying to stop it is a giant waste of time anyhow. The warming is already preordained, inevitable. Studying the rate moss dies in Alberta or the warming potential in a belch of methane is only a waste of your time and my tax dollars. Instead the entrepreneurs and innovators of the world should be the ones doing all the science. Study the future potential of growing corn in Labrador, expanding fisheries into the Arctic and Antarctic, irrigating arid parts of the world with the melt from the Greenland ice sheets, and so forth.
Studying the rate moss dies in Alberta or the warming potential in a belch of methane is only a waste of your time and my tax dollars.
Really now! Could you give us an exact number as to how much of your precious tax dollars are spent on such things?
Instead the entrepreneurs and innovators of the world should be the ones doing all the science.
Do any of you morons have any idea what science is, how it works and what kind of an education you need to have before you can actually call yourself a scientist and do research?
You want to save your tax dollars? Stop spending all the money on useless things like nuclear armaments, cruise missiles, aircraft carriers and fighter jets! Non of those things are effective any more and can be taken out by much cheaper robots, drones AI and cyber warriors.
The list of POB trolls just keeps growing…
Leo Halstead
Troy Slavski
Nicholas Schroeder
Jeffrey Bromberg
Leo Halstead
Troy Slavski
Nicholas Schroeder
Jeffrey Bromberg
I’m a idiot, and proud of it?
Green Day – “American Idiot” [Cover by Robert Matlock]
https://www.youtube.com/watch?v=q-7t9IVhoOk
Most of NE Canada, including Labrador, is the Laurentian shield, which is bare rock or very thin soil, some bogs. The soil that was there got pushed south by the glaciers – it’s whats used to produce a lot of the cereal in Canada and USA today. There’s some new stuff along some rivers but not much (easy to check in more detail with google search, quite a lot of data from the provincial governments for Quebec and Newfoundland and Labrador -probably paid for by Canadian’s tax dollars)
“irrigating arid parts of the world with the melt from the Greenland ice sheets”- that’s a new level of cornucopia I haven’t seen before – there have been studies of towing ice bergs to the middle east (probably paid for in part directly by you buying their oil). Trouble is beyond a certain temperature proteins start to denature and living things die, doesn’t matter how much water they get, and things can be great 99.9% of the time and too hot the rest – and there still is no crop (google might find more data for you – I haven’t looked).
A stark reminder that anthropogenic climate change can cause very rapid environmental and geologic changes. Here is a clear example of a tipping point that was recently passed.
https://www.nature.com/ngeo/journal/vaop/ncurrent/full/ngeo2932.html
River piracy and drainage basin reorganization led by climate-driven glacier retreat
Daniel H. Shugar, John J. Clague, James L. Best, Christian Schoof, Michael J. Willis, Luke Copland & Gerard H. Roe
AffiliationsContributionsCorresponding author
Nature Geoscience (2017) doi:10.1038/ngeo2932
Received 05 December 2016 Accepted 13 March 2017 Published online 17 April 2017
Abstract
Abstract• References• Author information• Supplementary information
River piracy—the diversion of the headwaters of one stream into another one—can dramatically change the routing of water and sediment, with a profound effect on landscape evolution. Stream piracy has been investigated in glacial environments, but so far it has mainly been studied over Quaternary or longer timescales. Here we document how retreat of Kaskawulsh Glacier—one of Canada’s largest glaciers—abruptly and radically altered the regional drainage pattern in spring 2016. We use a combination of hydrological measurements and drone-generated digital elevation models to show that in late May 2016, meltwater from the glacier was re-routed from discharge in a northward direction into the Bering Sea, to southward into the Pacific Ocean. Based on satellite image analysis and a signal-to-noise ratio as a metric of glacier retreat, we conclude that this instance of river piracy was due to post-industrial climate change. Rapid regional drainage reorganizations of this type can have profound downstream impacts on ecosystems, sediment and carbon budgets, and downstream communities that rely on a stable and sustained discharge. We suggest that the planforms of Slims and Kaskawulsh rivers will adjust in response to altered flows, and the future Kaskawulsh watershed will extend into the now-abandoned headwaters of Slims River and eventually capture the Kluane Lake drainage.
If you are not part of the solution, you are part of the precipitate!
“We’ll deal with it just like any other adversity faced in world history. ”
Yep, expanding into more primitive territory as population rose and farmland became less productive. Genocide of the indigenous population. Then wrecking much of the natural heritage of the region for profit, poisoning it, overpopulating it then building weapons of mass destruction to destroy large areas of the planet while parasitizing the new indigenous population (ceremoniously called citizens). Sure humanity will continue doing what it has done before.
Next the Arctic and the oceans, even Greenland. Hurry though, things are changing fast so the meme of “more and more” is coming to a close. Panic! Snake will eat it’s own tail soon.
“We’ll deal with it just like any other adversity faced in world history. ”
According to genetic and fossil evidence, archaic Homo sapiens evolved to anatomically modern humans solely in Africa, between 200,000 and 100,000 years ago, with members of one branch leaving Africa by 60,000 years ago and over time replacing earlier human populations such as Neanderthals and Homo erectus.
Source Wikipedia
Compare that to WORLD HISTORY Which is about 4.5 billion years…
To put it all in a geologic perspective, our most recent batch of trolls are dumber than rocks!
“Paging Doctor Oz! A patient calling itself The United States wandered into the emergency room disoriented, wearing a filthy warm-up suit, claiming it was “the greatest” this and that… but was unable to complete the nine-page admission protocol or present valid insurance ID. Patient is growing increasingly violent, threatening staff and other patients….”
-JHK
Let’s see now: how did 30 to 60% of Europe deal with the black death – oops they all died; how did 6 million Jews deal with Hitler – they all died; how did the German states deal with the 100 years war – 7.5 million (one third) died; how did the world deal with Mongol invasion – 5% died; how did North and South American natives deal with the coming of Europeans – um … they almost all died; how did Chaco canyon culture deal with resource depletion – it disintegrated; how did Iceland deal with the 1783 Laki explosion – 25% died. Yep, sounds like we can deal with pretty much any problem.
How did we deal with Y2K???
We prevented it! Rather than just letting it happen, and dealing with the consequences. That’s the smart approach. Ditto the whole idea of vaccines – prevention!
A quibble: “how did 6 million Jews deal with Hitler” – don’t forget the other 6 million who died: the gypsies, the gays, the political dissidents, etc., etc.
Y2K isn’t exactly explosions, invasions or serious diseases, Nick, however your points about prevention, and smart approaches, etc., are well taken.
I picked a nice spring flower for you by the way. Here; ?
It’s kind of small, but it’s supposed to be a tulip. If you use your browser’s zoom-in, you should be able to see it better.
Any of ya’ll have a wife or kids? I have a hard time believing it, because ya’ll wouldn’t have the time or interest to become worried sick over nonsense if ya’ll had wives and kids to give attention to.
Any of ya’ll have a wife or kids?
Uh, yeah, and we worry that they won’t make it to middle age because of the effects of global warming and coming fuel shortages.
I’ve got a son in college, Fred has one of a similar age, Ron’s and Doug’s are grown…don’t remember about the rest, though my guess is that at least 75% of us have kids.
Pretending there’s nothing wrong is not an example I want to set for him.
But if you want to go ahead with your pointless superstitions and lie to your children about the state of the environment…
you’re a typical American.
If you want to spread disinformation, deny science, and prevent others from exercising critical thought…
you’re some kind of evil.
Au Contraire Mon Ami!
It is precisely because I am a dad that I give two shits about the future. And because I have a background that made me scientifically literate, I have an inkling about what is coming down the pipeline. Unfortunately it doesn’t look all that great. Funny thing about reality, it doesn’t give a rodent’s rear end, whether or not you like it, believe it, accept it or not. It just is!
Edit: just saw that Lloyd beat me to the punch!
Ditto that.
I disagree, nature not only cares but is extremely cooperative. Seeing that we were doing so much to cause a large extinction and make a warmer world, nature was only too glad to chime and help the whole process along.
We could have pleasantly gone into another glaciation, but with a little effort on our part and some help from mother nature we won’t have to move south to stay warm.
And you thought nature was not on our side.
Apparently we like really sunny days and deserts too. Guess what?
Any of ya’ll have a wife or kids? I have a hard time believing it, because ya’ll wouldn’t have the time or interest to become worried sick over nonsense if ya’ll had wives and kids to give attention to.
If this blog had a screen that would not allow anyone with an IQ below 75 to comment, then we would not have to put up with such stupid comments from folks like Peggy Hahn.
My wife and kids are very self amusing and low maintance. As a result I have a lot of opportunities to read and pursue a wide variety of interests. I can’t imagine how having a wife and kids would prevent one from having outside interests. I’d suggest that you Peggy have just made the dumbest comment ever seen on the pages of this fine blog. Do you suppose the folks that research cures for diseases and develop new technologies are all single? Have you ever been for a drive that exceeded the boundaries of whatever inbred county it is that you live in?
“Do you suppose the folks that research cures for diseases and develop new technologies are all single?”
Yea I would have. My mother taught me all men need a hobby, but men who stay single are the ones likely to turn hobby into obsession. Men in jobs creating things making our lives better are the ones who can only advance if they are obsessed enough, I would think.
You’re oblivious to reality and human nature on so many levels it’s hard not to feel embarrassed for you. How you ended up taking an interest in reading the topics discussed at this fine blog is hard to fathom. I can’t imagine you having an interest in science, peak oil, geology, net energy flow, world-systems analysis, or anything outside of what might be featured on the Jerry Springer show. How’s you end up here Peggy? It surely can’t be any kind of academic or scholarly curiosity.
My brother in law moved his wife and 5 kids to North Dakota to get a job in the Bakken Oil Boom Miracle. All the good jobs here are gone, or hire only illegals/hispanics. He moved last year, but had a real hard time getting any jobs besides cashiers and janitors. I told my sister to have him lie down the bottle, keep Praying to God for help and found this web site, which I passed along hoping he would see where he could look for jobs based on where new oil was gonna come up.
Huh, job research eh. Peculiar. Better than saying it was gas prices I guess.
http://peakoilbarrel.com/open-thread-non-petroleum-dec-1-2016/#comment-587866
My point being that it seems to me that the real people here arrived due to an interest in peak oil, whereas those that come across as anti-science sock puppets seem to have in common a claim of serendipitous discovery of this fine blog due to a somewhat tangential internet inquiry. You guys need to huddle and shake up the modis operandi a bit.
http://www.teamtechnology.co.uk/troll-tactics.html
My guess is that elements of the WUWT crowd slithered over when the non petroleum thread open up.
“All the good jobs here are gone, or hire only illegals/hispanics.” – maybe they prayed harder than you did, or maybe your God just likes them a bit more than you.
PeggySue, this is the last place God would have sent you. I think you got your signals crossed. Maybe you should try planned parenthood or tell your sister to cross her legs and here her husband get a different hobby.
I told my sister to have him lie down the bottle, keep Praying to God for help and found this web site, which I passed along hoping he would see where he could look for jobs based on where new oil was gonna come up.
Sorry, in case you didn’t get the memo… The fossil fuel industry on planet earth is in its waning days. Maybe he can still catch the next shuttle to Titan. Though if he has issues with aliens who speak Spanish, I doubt he’s going to get along with the Aliens he’ll meet at the work camps on Titan… He might want to learn Klingon.
yIDo’!
Peggy- For the record, I am a married man, and Ron who responded to you earlier (and founded this discussion board) just became a widower this past month.
And regardless of that whole issue- there is nothing wrong with having a concern about the big issues facing humanity- and discussing them.
If you find that odd, good for you- go somewhere else.
I didn’t do a internet inquiry to find this web site. I was reading about The Bakken on Yahoo finance and saw Ron Patterson’s Bakken articles on there.
I didn’t do a internet inquiry to find this web site. I was reading about The Bakken on Yahoo finance and saw Ron Patterson’s Bakken articles on there.
The question is not how you got here…the question is why the fuck do you keep coming back?
It’s a Dunning-Kruger world, the best world in the solar system…
@Fred:
Klingon isn’t a real language. Don’t you know anything? If there was a language on Titan, it would more likely be called Titanium. Cuz, ya. Anyway, have a pizza: ? It makes a great hat if you’re not so hungry, but just let it cool off a bit first.
@Peggy:
I was picking tulips earlier for my home and one for my Nick G, and, well, here’s one for you too. These things don’t seem to wilt: ?
Came for the job search, stayed to criticize science and those that study it. That’s the lamest story I’ve heard in a long long time. Check with your line manager at the sock puppet brigade. They’ll likely have some pointers on how to improve your modis operandi.
?Wow! Look at all these replies to Peggy!?
Hi Peggy,
Wind turbine technician might be a good avenue for your brother-in-law or your sister, or installing solar panels, building energy efficient homes.
Technical education may be a good avenue to a good paying job.
“He moved last year, but had a real hard time getting any jobs besides cashiers and janitors. I told my sister to have him lie down the bottle”
I think his job finding problem can be found in a bottle.
NAOM
Klingon isn’t a real language. Don’t you know anything?
Caelan,
Aside from the fact that a statement about catching a shuttle to work on Titan is something that most people of average intelligence would take as a hint that the entire comment was intended as sarcasm, you are wrong about Klingon not being a real language.
http://screenprism.com/insights/article/how-was-the-klingon-language-developed
By all accepted definitions of the term, Klingon qualifies as a real language. It is the structured written and verbal means by which Klingons communicate in the fictional Star Trek (1966) universe. It may not be as extensive and complete as English or Spanish, but Klingon is realized enough that fans can engage in full conversations, works of literature have been translated into Klingon, Bing offers it as a choice in their online language translation tool, and, in all likelihood, this summary of its development could be written in Klingon.
Don’t you know anything, Caelan?
Hi Fred, aside from the fact that my comment-in-question was ‘of course’ intended as casual humor and therefore– and along the lines of much humor, artistic license and all that– not quite an ‘accurate treatise’, indeed Klingon may be some sort of actual working language, and, if so, it might be fun to learn and know, if I had another lifetime to spare or, say, lived on the fictional Klingon ‘homeworld’.
That writ, I am happy to leave such details with you. Maybe your CRISPR can add that extra lifetime wherein we could venture to an inhabited planet where its inhabitants speak a language reminiscent of Klingon phonetics, and who would be thrilled to incorporate ours into some sort of working dialect.
But again, I’ll leave that to you, Elon Musk, Tony Seba and The Thought Leader Industrial Complex. “Go, Team!”
Caelan, without going too far down the rabbit hole, DNA is a language and CRISPR is a DNA editor. That was part of the reason I posted the XKCD comic the other day…
UC Davis CRISPR Mtg: Vital Role of Language in CRISPR
https://ipscell.com/2016/05/uc-davis-crispr-mtg-vital-role-of-language-in-crispr/
…Michael spoke next. He is as Associate Professor English so that brought a unique, valuable perspective. He discussed the language of CRISPR with a title of “DNA as language.” or protolanguage. He cited the “CRISPR Heroes” article by Lander and CRISPR, The Disruptor article in Nature.
He proposed a double major idea, such as in English (or history, etc.) and Biology. Why the separation of “The Two Cultures”? DNA is a language, not a code. The body is the text. It’s clear that he doesn’t like “editing” as a metaphor. Why? He mentioned one reason as being that editing also implies there are authors and experts.
When he said, “We don’t have native speakers of DNA” that kind of hit home. He also said that learning DNA is like learning Klingon. Finally, he asked, “How will we know when we become fluent in DNA?”
You can encode any English phrase in DNA
http://earthsciweb.org/js/bio/dna-writer/
Example:
GACTGTGATAGCTCATGTGATATCTACAGCATGCACCTGTAGCTAAGCACTCTCGACAGCCTACTCGTCATCCTGTGACGTAGCGAGCGTCACACTTGACTAAGCCTGCTCAGCTACCTCACT
You could then insert that DNA fragment into the genetic code of a living cell as your signature.
Cheers!
Thanks for sharing, but not impressed, Fred.
There are a lot of things that humans can and should do, but don’t, and a lot of things that humans can but shoudn’t do, but do anyway. And what humans can, should and sometimes do, they far too often do them poorly and/or improperly, and so maybe they shouldn’t be doing them in the first place.
It’s possible that if God existed and accepted the Darwin Award for en entire species, and was canvassing nominations, I’d seriously consider nominating humans.
“Any of ya’ll have a wife or kids?”
Grandkids, and I’m worried sick about their future because deniers like you are working overtime to help destroy the planet’s biosphere that they depend on.
re your reference to God, below,…
When God created Adam, he showed him all the trees of the Garden of Eden and said to him: “See my works, how lovely they are, how fine they are. All I have created, I created for you. Take care not to corrupt and destroy my universe, for if you destroy it, no one will come after you to put it right.”
(Ecclesiastes Rabbah 7)
“We’ll deal with it just like any other adversity faced in world history.” – Jeffrey Bromberg
Agreed, and assuming that the agenda of the gene is to select for intelligence, then I don’t think you’re going to like it, the “dealing with it” that is, very much. Perhaps the herd could use a good thinning.
https://en.m.wikipedia.org/wiki/Population_bottleneck
“What will they say when a giant plateau more than a mile high and twice the area of the Himalayas disappears?”
Damned good question. The increased heat gain due to the loss of the ice over such a large area will make a big impact, no question, especially considering positive feedbacks.
I haven’t seen much discussion of what the loss of the ice pack will mean in terms of the prevailing winds. The Himalayas are three or four times as high, and stretch out a lot of miles, and mostly block and divert what would otherwise be prevailing winds, thereby playing a truly major role in climate. I’m thinking long and high trumps surface area , in terms of climate effects, in comparing the two, but this is just a seat of the pants guess.
If the Greenland ice cap melts, the remainder will be on average several thousand feet lower in elevation.
This might well be enough of a change to result in changes in the prevailing winds.
Any links discussing this possibility are welcome,and thanks in advance.
Loss of the Greenland ice sheet would effect both global and regional atmospheric circulation. Note the sentence ” Much of the world’s current pattern of rainfall would be altered.”
Global heat transfer: The loss of Greenland ice mass would affect global atmospheric heat movement. Any heat transfer is driven by a temperature difference. The greater that difference, the faster heat flows. As the polar regions warm, the temperature difference between the equator and the poles is reduced, altering global atmospheric circulation patterns by reducing the force that drives equatorial heat energy toward the poles. Much of the world’s current pattern of rainfall would be altered.
Regional atmospheric circulation: On average, the top 2,560 meters (8,400 feet) of Greenland is ice. Like a mountain range, this physical mass affects regional atmospheric circulation patterns. If (as) Greenland’s massive range of ice melts, regional circulation patterns will also change.
https://earthobservatory.nasa.gov/Features/Greenland/greenland_sidebar.php
And the melt gets faster as the height falls because the surface experiences warmer temperatures at lower altitudes – not something I’d really thought about before as mile high ice mountains aren’t easily appreciated.
Warm temps and April rain showers for southern Greenland. I’m very curious to see how increased rainfall contributes to the future erosion of the Greenland ice sheet.
http://pamola.um.maine.edu/fcst_frames/GFS-025deg/5-day/GFS-025deg_ARC-LEA_T2_max_5-day.png
http://pamola.um.maine.edu/fcst_frames/GFS-025deg/5-day/GFS-025deg_ARC-LEA_PRCP-TCLD-PMSL_5-day.png
As well, it will be interesting to see how pulses of fresh water impact ocean changes as the frequency of glacial aquifers rapidly draining increases, if it does.
https://phys.org/news/2017-02-nasa-pathway-greenland-meltwater-ocean.html
Furthermore,
Amplified melt and flow of the Greenland ice sheet driven by late-summer cyclonic rainfall
“Given that the advection of warm, moist air masses and rainfall over Greenland is expected to become more frequent in the coming decades, our findings portend a previously unforeseen vulnerability of the Greenland ice sheet to climate change.”
http://www.nature.com/ngeo/journal/v8/n8/full/ngeo2482.html
https://www.theguardian.com/environment/climate-consensus-97-per-cent/2015/jul/14/global-warming-is-causing-rain-to-melt-the-greenland-ice-sheet
In recent years in the Arctic there has been a persistent high temperature anomaly that has broken to significantly cooler air temperatures in May, the forecasts look like that may happen again. If not, or if the sea water warmth overwhelms everything else then I don’t see much sea ice surviving, and the excess available heat is going to hit Greenland ice.
CLIMATE CHANGE CLUES REVEALED BY ICE SHEET COLLAPSE
The rapid decline of ancient ice sheets could help scientists predict the impact of modern-day climate and sea-level change, according to research by the universities of Stirling in Scotland and Tromsø in Norway.
https://www.sciencedaily.com/releases/2017/04/170424093950.htm
Since the Arctic is expected to have a 6C rise in temperature or greater, I would say that the term accelerated melting has not been fully understood as yet.
Meanwhile the Southern Ocean and Antarctic will continue to enjoy a large input of light energy for thousands of years into the future due to orbital parameters. The minima of insolation was reached 11,000 years ago and will not be repeated for another 100,000 years.
I agree, however, climate scientists are reluctant to drop the 6C bomb which is kind of final, like Armageddon. Saying 3C makes it all sound as if we can work things out — somehow. Greenland, at 6C, will become a collection of rocky islands and a large number of cities will be vying for the “New Atlantis” title. You know, Scuba dive New York’s Galleries and Museums sort of thing.
People generally got a snapshot of the earth during their lifetime. Things generally stayed the same until lately. Now we get to see large changes within one lifetime. We get to see the first few hundred frames of the movie “Changing Earth”. Pick a genre for that film.
LOL
The models reproduce the polar amplification and reduced sea ice check out GISS model E
https://www.wired.com/2015/04/dmca-ownership-john-deere/
This kinda thing just gladdens the heart of the business community, and all right thinking people who understand the proper place of the under classes,under our heels, but we need to be careful about overdoing it.
Otherwise we might piss off some people who own machinery to the point they actually start votin’ Dimmerkrat.
It’s one thing to fuck with a kid with a five hundred dollar phone, and it’s something else to fuck with a man with a million dollars tied up in a couple or three machines who wants to fix them himself, or hire his own mechanic.
Hey Trumpster—
How about organizing a March for Extractive Industrial Capitalism?
Those clever humans have already hacked Deere, and one can get the code online.
A public station was covering it in a rural part of NorCal (not a oxymoron) .
Trumpster sez Please provide more details, and we will send a crew to arrest the people who hacked the code, and everybody who has helped disseminate it . Can’t be having this sorta thing, it’s ‘gainst the law, and we gonna put a stop to it, and make an example.
Trumpster sez
Who do these stupid farmers think they are, that they own a tractor just because they paid for it? No siree, that tractor ‘blongs to the COMPANY, and the COMPANY belongs to the STOCK HOLDERS, and by God, if he wants it fixed, the stupid farmer can just call the dealer, and or let it sit out in the field and rust away.
https://en.wikipedia.org/wiki/Digital_Millennium_Copyright_Act
It passed ninety nine to zero in the Senate, with every Republican except one who must have been out of town for some reason and every Republican LITE so called Democrat voting for it.
Trumpster sez we Trumpsters look after the folks with the money, and fuck everybody else, and we’re glad to have Republican Lite so called Democrats holding a few seats, they’re ok, they generally go along no problem.
OFM is of the opinion that this sort of thing doesn’t matter very much if you’re talking about music and paying a few dollars for the right to listen to it.
It matters one hell of a lot when it comes down to the balance of power between individuals, communities, and the synthetic immortal life form known as a corporation, which cannot be punished, cannot be jailed, which cannot feel pain of any sort, which has no built in inhibitions or morality of any sort.
OFM says he’s too old to buy any more new equipment now, but there’s already a lot of people, including farmers and the owners of small construction and trucking companies, etc, who are making the decision to repair and refurbish older equipment after having to pay outrageous prices for service calls when new equipment breaks down, and there’s no way to get the data needed to fix it, it’s the dealer or nothing.
Who will control the country, and the economy? The R Lite Democrats aren’t doing much to slow down the Real R’s efforts to consolidate power on Wall Street and in corporate board rooms.
Every once in a while, even the enemy gets something right, or has a valid criticism to offer.
http://hotair.com/archives/2017/04/23/dnc-chair-declares-no-place-pro-life-democrats-todays-party/
Now this is from a right oriented author, but here’s a quote any and every big D Democrat in America should read over and over, and maybe copy it on the chalkboard a hundred times, while wearing a dunce cap, IF by some chance he or she would rather WIN ELECTIONS than just bitch about how nasty and low life the opposition is.
” Nobody at the state and local level is beholden to either the national Democratic or Republican parties, nor are they sworn to uphold the party platform line for line. This is a lesson that the GOP had to learn the hard way after the purge in the 2008 to 2010 era. The GOP needs their RINOs, particularly the ones in the northeast, if they want to hold on to a majority in the House. The same applies to state legislatures, county commissions and school boards. It’s worth remembering that the New York GOP congressional delegation fell to a grand total of three seats during that period after previously holding more than a dozen. (We’ve been slowly recovering, but it was a rough patch for the party.)
If the Democrats want to weed out every single candidate across the nation who opposes abortion they will be driven further into the wilderness than they are now. Pro-abortion speeches sell really well in the coastal cities where Democrats hold large majorities and raise most of their money, but there’s an awfully large swath of the country in between where that’s not going to win you an election. I get that Perez needs to appease his base during the tumultuous transition they’re currently going through, but if he’s actually interested in doing the job he fought so hard for he needs to start delivering some wins. And you don’t do that by letting the most extreme wing of your party write all of the rules.”
There are millions and millions of people who simply will not even CONSIDER voting D because they really and truly do believe abortion is murder, or something close.
I don’t have any problem seeing it both ways. Maybe it helps that one of my sisters specializes in keeping preemies alive, and she and her fellow professionals are winning the fight, more often, with ever younger ( fill in this blank with baby, fetus, hunk of meat , etc, as your personal prejudices dictate. )
She believes abortion should be a woman’s right, and has counseled many young women that an abortion would be in their own best interests, but she spends most of her working days looking after babies born early.
The real question, in terms of party politics, is this one. Which is more important, ideological purity, or regaining power ? D’s in the wilderness aren’t in a position to do much for women or anybody else, and the fewer D’s win, the more Trumpsters win.
I don’t have any problem seeing the ideological purity argument from both sides so far as that goes. If you ( rhetorical ) stick to principles, you can hope to prevail in the long term, although you may lose in the short term. Sanders supporters lost short term, but hopefully they will prevail in the long term.
Lurking, and ready to strike:
The ragged remnants of the neo-conservative cabal that came together under George W. Bush is still out there, plotting and scheming, concocting novel new ways to light the world on fire for power and profit. The Project for a New American Century (PNAC), think-tank mothership for every bad neocon idea that led us into Iraq and a wider conflict in the Middle East, never died; it just got new offices down the block. Unlike their counterparts in the current administration, the neocons know how the gears of government work, where the levers are, and how to actually get things done. Combine the wild fervor of Trump’s band of wreckers with the ice-eyed competence of the neocon assassins, and the result could be horrific beyond any known measure.
I would say it’s past the lurking stage, that the striking is well underway.
https://techxplore.com/news/2017-04-prudent-invest-carbon-free-electricity.html
I was asked to give a presentation for a March for Science event in Sault Ste. Marie, MI. Here is my presentation:
We’re here today largely because there are those in denial of basic scientific knowledge concerning climate science, some who claim that global warming is all a hoax.
The origins of this hoax date back to 1827 when Jean Bapiste Fourier published a scientific paper in which he concluded that certain atmospheric gases trap heat and warm the atmosphere.
In the 1850s, John Tyndall made quantitative measurements of the heat trapping capacity of various gases, including CO2.
In 1896, a Nobel prize-winning chemist by the name of Svante Arrhenius published a scientific paper in which he calculated a significant increase in atmospheric temperature due to a doubling of atmospheric CO2 concentration.
This scientific work was achieved without the sophisticated instrumentation that exists today, illustrating that the basic science of the greenhouse effect was not that difficult to establish.
In the 1930s, an American physicist by the name of E.O. Hulbert confirmed the relationship between CO2 and atmospheric temperature increase that Arrhenius had calculated.
In the 1950s, a Canadian physicist by the name of Gilbert Plass, while doing work on IR radiation for the U.S. Department of Defense, concluded that some atmosphere gases absorb IR radiation, thus trap heat, one of which is CO2 and that a doubling of the atmospheric CO2 concentration would lead to a significant temperature increase.
In the 1960s, top government scientists were warning President Johnson about global warming.
Now the evidence is overwhelming: reduction of outgoing IR radiation from the atmosphere, increasing sea levels due mainly to thermal expansion, fairly rapid melting of glaciers and ice sheets, and increasing global temperatures.
I monitor temperature data for SSM and numerous other locations in northern North America. In the case of SSM, in the 1970s, the average temperature for the decade was 39.77 F. For the 2010-2016 period the average was 42.94 F. If you were here in the 1970s, you should have a clear sense that it’s warmer now than in the 1970s. Locations farther north have larger temperature deviations than SSM from 1970s averages.
The overwhelming driver for climate science denial is greed. Short term acquisitive self-interest is all that matters to some. The long-term consequences are not important.
About 5 years ago, Kevin Anderson, one of the world’s top climate scientists, said that we had to immediately reduce CO2 emissions by 10%/year globally to prevent serious long-term changes. So far we have yet to see a decrease globally.
What most people don’t know, or don’t appreciate, are two phenomena: thermal inertia and positive feedback.
Thermal inertia ensures that even if we stopped putting CO2 into the atmosphere today, global temperatures would rise for many decades before thermal equilibrium was established.
Warming will be most pronounced at higher latitudes, changing the surface reflectivity, albedo. That alone is creating a strong positive feedback. Melting of the permafrost in the Arctic and methyl hydrates in oceans, particularly the East Siberian Continental Shelf, will lead to significant degassing of CO2 and CH4, a powerful greenhouse gas.
We may be too late already to prevent significant warming due to positive feedback from degassing of CO2 and CH4.
One aspect of warming that isn’t well known is that many of the world’s major agricultural areas are expected to get a lot drier over time, including the U.S. On our current trajectory, Michigan is projected to be as dry as northern Texas by the end of the century. How will that affect agriculture?
Global warming is a slow moving phenomenon but once it starts, it’s not easily stopped. It will have long-term consequences irrespective of whether people accept the science or not. Time is presently wasting away and denial isn’t helping the situation.
“In the 1850s, John Tyndall made quantitative measurements of the heat trapping capacity of various gases, including CO2.”
There was somebody else B4 Tyndall, a fact I was reminded of just the other day. An American woman beat him by 3 years….
Eunice Foote was an amateur scientist with a lively interest in many topics, from campaigning for women’s rights to filing patents for boot soles. In 1856, she wrote a paper https://books.google.co.uk/books?id=fjtSAQAAMAAJ&pg=PA382&lpg=PA382&dq=%22Circumstances+Affecting+the+Heat+of+the+Sun%E2%80%99s+Rays%22+foote&source=bl&ots=j5MLp3r_i4&sig=pfHXWv44uTHzjMyCAx_vjOnxlyU&hl=en&sa=X&redir_esc=y#v=onepage&q=%22Circumstances%20Affecting%20the%20Heat%20of%20the%20Sun%E2%80%99s%20Rays%22%20foote&f=false
for the annual meeting of the American Association for the Advancement of Science, reporting on her measurements of the heat-trapping properties of carbon dioxide. She even speculated that if, “at one period of [earth’s] history the air had mixed with it a larger proportion [of CO2] than at present, an increased temperature from its own action must necessarily have resulted” – in other words, if there were more carbon dioxide in the atmosphere, then it would trap more heat, and the earth would be warmer
http://blog.ucsusa.org/katharine-hayhoe/climate-science-its-a-lot-older-than-you-think
Paid for by the Committee To Repeal and Replace Tyndall with An American Woman
https://youtu.be/C_fNGa26hig
On our current trajectory, Michigan is projected to be as dry as northern Texas by the end of the century. How will that affect agriculture?
Dunno, dried jellyfish sandwich, cricket drinks, with cactus salad anyone?
https://www.youtube.com/watch?v=NknAeYIkAbY
https://www.eatthismuch.com/food/view/dried-jellyfish,5786/
.
We eat cactus, down here, already. A tasty veg, I should eat more of it.
NAOM
Bloomberg news posting- that gives a version of the oil/electric vehicle issue interplay. Well done, although they forget to consider that little factor called ‘depletion’-
https://www.bloomberg.com/news/articles/2017-04-24/the-electric-car-revolution-tesla-began-faces-its-biggest-test
How long it will be until perovskite replaces silicon in solar cell? Will it replace silicon?
https://techxplore.com/news/2017-04-prudent-invest-carbon-free-electricity.html
I’m not even a well informed tradesman when it comes to solar electricity theory and practice, so I’m hoping that somebody here knows more about this, and the likelihood of success.
removed
Perovskites used in solar cells contain lead and are highly water soluble. So there are some environmental questions that might to be considered. At least there would have been in the recent past.
I am also not sure about the stability. A few years ago I heard some negative comments about this, but it may have been resolved by protecting the material from UV radiation. Amorphous silicon has proven 30-40 year real world lifetime.
So it’s hard to imagine that perovskites can replace silicon anytime soon, but the efficiencies are very good, and may be lower energy cost to produce.
Siberian Wildfires
http://siberiantimes.com/other/others/news/large-wildfires-and-major-flooding-as-siberia-faces-a-spring-thats-both-dry-and-wet/
Robert Scribbler has a post up on the topic also. I like that he covers stories that highlight the current events, however some of his stuff is a bit too heavy on the hopium for my tastes.
It’s not good for your health to only get enjoyment out of bad gloomy news. ?????
Troy, you are a hapless idiot!
Most of us here are actually realists.
http://glowballwebnetwork.com/difference-between-optimists-pessimists-and-realists/
A realist is someone who tends to view or present things as they really are at this moment in time. They normally don’t worry about what was (even though they are aware) and also don’t dwell on what could be. They work and live in the moment, what is currently at hand. Even stranger is pessimists view them as optimists, and optimists often view them as pessimists.
What I found to be extremely fascinating is the outcomes that were derived from these various groups. Again it depends upon the situation, it always does which makes it hard to determine which group is best.
Case in point; during the Vietnam conflict, US soldiers who were taken as prisoners of war and held captive undetected for long periods of time. Once our troops eventually discovered these camps and rescued prisoners, the ones who made it (long term) were often realists. In fact after looking deeper into the matter, it was discovered that usually pessimists died first, closely followed by optimists which baffled the command. They thought if anyone would make it, it would be the optimists.
However, after further examination even the optimists who believed they would be rescued at anytime often lost hope in time and ended up giving in which resulted in giving up and their demise. Only the realists made it because they lived one day at a time and made the most out of that day, day in and day out expecting nothing more.
I feel that it’s important to consider future trends, and indeed I enjoy it. The famine relief centers will be full of Troy’s and Peggy’s. Maybe they plan on God giving them the ability to shit silver dollars.
Hi Troy,
Do you think Survivalist gets “enjoyment out of bad gloomy news?”
Please elaborate.
I guess what Troy is saying is that I enjoy it and it’s bad for my health. I guess that makes it a vice. I tend to think that knowledge/info is a virtue, as is a willingness to share it/post it. One thing I like about the non petroleum thread is all the great links to stuff I would usually never come across. Everything from OFM to HB to Nick G to all kinds of interesting stuff. I really appreciate what gets posted here and I hope I can somehow provide the same thing to others by expressing what interests me. Troy, as usual, has nothing but foolish opinions to share. For Troy, ignorance is bliss; a virtue. Information is bad for you. It’s pathetic.
Well I don’t ever see him sharing good happy news here. A comment like “some of his stuff is a bit too heavy on the hopium for my taste” suggests he especially wants to see only doomy gloomy stuff. ?????
Sorry for not having enough time to find a proper meme this time around. ????
Hi Troy Slavski,
What is your opinion of Robert Scribbler’s blog and his viewpoint on the urgency of addressing climate change? I tend to agree with Survivalist that Robert Scribbler can come across as being overly optimistic in that we have the capability to address the issue of rising emissions. Maybe we do have the capability, but not the will, as we continue to be driven by individualistic shortsighted greed. How do we solve that? That being said, I do remember Robert Scribbler specifically addressing the perception of him being overly optimistic, and he said if the optimists think it’s this bad, then we really are screwed. LOL
Anyway, if you do have some “good happy news,” please share it. I am being very honest that I would like nothing more than to hear that atmospheric CO2 levels are not accelerating. Not all of us are about doom and gloom. But the data refuses to cooperate, despite my positive thoughts! 🙂
Troy Slavski- the world’s only genius with an IQ below 70.
My health is great. VO2 Max is through the roof.
German car manufacturer Volkswagen has imagined a friendly new shape for cars of the future based on emerging electric and driverless technologies.
Sedric (SElf-DRIving Car) was unveiled yesterday at the 2017 Geneva Motor Show. It is the company’s first fully autonomous concept car, designed for a time when autonomous technology on the roads no longer requires the supervision of a human driver.
https://www.dezeen.com/2017/03/09/volkswagen-sedric-concept-car-driverless-future-transport-technology-design-geneva-motor-show/
El Nino probability had a big jump in latest Columbia ensemble analysis, up to almost 70% again. La Nina chances are almost gone now.
Hello, can you explain what this means for this year’s hurricane season along the N. Carolina coast?
Barrow (Utqiaġvik) now has CO2 in decline but it looks like certainly it hit 5 to 6 ppm peak to peak increase, compared to previous years’ showing 2 to 3 only. I think this is the most worrying of all climate trends that have had step changes over the last couple of years. Chart below is for flasks, in-situ is similar. Methane at Utqiaġvik has a similar, if smaller, uptick, as do CO2 and CH4 in other sites around the Arctic. I think there are far too many high concentrated high points for them all to be anomalous outliers. I haven’t seen any commentary on this so far in scientific journals or blogs.
https://www.esrl.noaa.gov/gmd/dv/iadv/index.php?code=brw
Meanwhile,
GLOBAL WARMING MAKING OCEANS MORE TOXIC, BREAKING CLIMATE CHANGE RESEARCH SHOWS
Climate change is predicted to cause a series of maladies for world oceans including heating up, acidification, and the loss of oxygen. A newly published study demonstrates that one ocean consequence of climate change that has already occurred is the spread and intensification of toxic algae.
https://www.sciencedaily.com/releases/2017/04/170424153809.htm
And, before you accuse me of Pollyannaism,
GLOBAL OCEAN DE-OXYGENATION QUANTIFIED
The ongoing global change causes rising ocean temperatures and changes the ocean circulation. Therefore less oxygen is dissolved in surface waters and less oxygen is transported into the deep sea. This reduction of oceanic oxygen supply has major consequences for the organisms in the ocean. Scientists have now published the most comprehensive analysis on oxygen loss in the world’s oceans and their cause so far.
https://www.sciencedaily.com/releases/2017/02/170215131546.htm
What does “flasks, in-situ” mean? Scientific code like the “hockey stick”?
flasks, in-situ… Scientific code like the “hockey stick?
Oh, Great! Another ignorant fucking troll who doesn’t even know how to use Google!
Guess you never took Latin or did any chemistry or biology experiments in a lab, did you?! Whatever could a flask be?!!! Must be some deep dark code…
Yet it’s idiots like you who have the gall to disparage science and working scientists.
Let’s just add you to the growing list of the scientifically illiterate POB trolls!
Charles Van Vleet
Leo Halstead
Troy Slavski
Nicholas Schroeder
Jeffrey Bromberg
Look, I’m almost to my 70’s and can remember a time when people were civil and polite to others when talking in public. You must be part of the newer generations that thinks it’s okay to cuss and be rude anytime and anywhere they want. That is terrible behavior which is part of the reason why morality in this country is in such a sorry shape.
If you actually want to help me, Yes I know what a flask is. I can remember using them back in High School biology/chemistry. I can’t say I ever seen the term in-situ or in combination with flask like in the above post. From my years reading Popular Mechanics I also know scientists like to use lots of big confusing terms the average person needs encyclopedias to figure out. That was my point with “hockey stick”. Obviously I know what a hockey stick is if your talking about the sport played on ice. Yet climate scientists aren’t going to be talking sports, but they use the term “hockey stick” anyhow in their e mails. Obviously the term means something else to them, so why shouldn’t an unusual term like “flask, in-situ” mean different things too which should be explained to those of us that don’t have careers in science?
Perhaps behaving like a troll will get you treated like one. Well, I don’t have a career in science and am not of the younger generation either but it is pretty simple to understand. You have already said you know what a flask is and you did biology/chemistry; thus you should know about analysing a sample in a flask. As for ‘in-situ’ you should also be familiar with Latin from your biology/chemistry days, here is a hint
https://en.wikipedia.org/wiki/List_of_Latin_phrases
So, how did you get to this site? Did you use Google? If so then you could have just Googled the information.
NAOM
Look, I’m almost to my 70’s and can remember a time when people were civil and polite to others when talking in public. You must be part of the newer generations that thinks it’s okay to cuss and be rude anytime and anywhere they want. That is terrible behavior which is part of the reason why morality in this country is in such a sorry shape.
BOOH HOOH HOOH!, cry me a river! You want civility?! Don’t come to a site where quite a few people are career scientists and attack their integrity, ethics and morality, not to mention their intelligence, with a constant stream of BS and statements saying that they are milking the poor tax payer of their hard earned dollars. Let’s hear you complain about military spending and the banking systems…
.
BTW at the bottom of that poster, those are representations of flasks
.
Oh, I just love the charm of this place. People here say they love science and learning for learning’s sake, but ask them to use their knowledge to explain an unfamiliar scientific concept to you and you get told something along the lines of: “go Google it, you stupid fucking idiot.”
Oh, I just love the charm of this place.
Fine! Then go troll some other site, you stupid fucking idiot! No one asked you to come here and insult science and scientists.
You know nothing about me! ???⚛??
I know everything about you that I need to know from the content of your posts and your stupid little emoticons. You are a fucking troll, bug off!
There’s this thing called Google, ever heard of it? Duh lol
https://en.m.wikipedia.org/wiki/In_situ
https://scripps.ucsd.edu/programs/keelingcurve/2013/05/20/why-scientists-still-collect-co2-in-flasks/
Stay in school kids!
Flask means they take a sample of air in the flask to a laboratory and analyse the contents. In situ means they have an instrument that directly measures at the sampling site, which presumably gives them more frequent and continuous measurements. Most testing around the world is through flasks, I think there are only three or four in-situ data sets, but if there are both then it allows independent confirmation of the results. Hockey stick wasn’t a code, it was a way of describing the shape of a curve, and only works for ice hockey sticks, so quite confusing for nations without much history in that sport.
Thank you for the clear explanation, George.
I agree George. If this data is backed up by similar results from other locations, this is very big news.
The inmates have taken over the asylum: BNEF The Future of Energy Summit kicks off in New York
Perhaps the top event was BNEF Americas Chief Ethan Zindler interviewing professional climate denier Myron Ebell, who oversaw the new administration’s transition at the U.S. Environmental Protection Agency (EPA). Ebell began by claiming a great respect for science but disparaging climate science, and generally went downhill from there, ending in a knot of Populist paranoia about “the technological industrial elite”, scientists, California, “the managerial class”, and a range of other alleged antagonists to hard-working heartland America.
It was truly something out of the Scopes Trial, but the joke is on the rest of us. Populism has been close to being the language of American politics since the 19th century, and these days is spoken better by Republicans. By doing so, Trump was able to put Oklahoma Attorney General Scott Pruitt as the head of the EPA, who now at work undoing years of regulation of not only greenhouse gas regulations but other regulations of pollutants in the power sector.
I’m sure OFM will find agreement with Debbie Dooley
De León and Dooley are at opposite ends of the U.S. political spectrum and represented very different perspectives, yet agreed on a surprising number of things. While de León affirmed that California would continue to work towards climate and renewable energy goals, regardless of the Trump Administration, Dooley did not engage in what could have been a standard partisan debate.
Instead, Dooley schooled the crowd on how to communicate regarding energy and the environment to conservatives, recalling a lesson from her father, a baptist minister, that you have to get people into the church before you can preach to them. One of her stronger points was that while conservatives may be turned off by discussions of the dangers of climate change, that they strongly support renewable energy on the basis of energy freedom and energy choice.
“I don’t care why someone wants to advance renewables, as long as they advance renewables,” stated Dooley. In the end, Dooley and de León ended up shaking hands in a remarkable moment of bipartisanship.
“I don’t care why someone wants to advance renewables, as long as they advance renewables,” stated Dooley.
Which is precisely why I like and follow, climate change denier and Trump supporter, Jack Rickard from EVTV http://evtv.me/
To be fair, I believe Jack is married to a Filipina and has mixed race kids, so he is a bit of an outlier amongst Trump supporters but his in depth work on Tesla drive trains and batteries and his support of solar is why I listen to him.
Hi Islandboy,
I don’t know this Debbie Dooley, but she sounds like she has her head on straight and her eyes open.
There are many millions of technically well educated conservatives who more or less just refuse to take climate science seriously, not because of the actual data, arguments, theory, etc, but because they are either opposed to the right left culture war, and see climate activists as being part of the enemy cultural coalition.
There are tens of millions more who are technically more or less scientifically illiterate, who really do think the climate science community consists of nut cases and scammers out get an easy living out of the government, etc.
ALL of these people, plus a some more millions of middle of the road people who pay almost no attention to politics, and could care less about the right left culture dispute, are generally willing to listen to any argument that is presented skillfully, meaning without pushing the WRONG HOT BUTTONS, and which indicates it’s about something with SOMETHING IN IT FOR THEM.
One on one, I get great results talking about renewable energy, clean water laws, clean air laws, publicly funded medical research, busting up the medical, legal, pharma, energy trusts ( mostly referred to these days as oligopolies, monopolies, interlocking directorates, special interest groups, …)
It’s no trouble at all to get an old country guy to agree with you that one reason people are so prone to have heart attacks, etc, these days is that big biz is selling them food packed with nasty chemicals, and the good ingredients separated out for chicken and hog feed, with the REST being sold as people food, and actually there is a GREAT DEAL truth in this observation. White bread is stripped of important nutrients that wind up in pet and animal feed for example.
You won’t run up on many who haven’t learned by now by actual observation just how dangerous tobacco is, having watched friends and co workers dying younger because they are smokers, and if you handle it right, they will see the truth in the argument that while ADULTS should perhaps be free to do to suit themselves, including killing themselves indulging in bad habits, JUST MAYBE it ought to be against the law for fast food companies and soft drink companies to advertise to kids.
You talk about how long it takes to teach the kids good habits, or good values, for instance how it’s important that the kids ( among church goers ) go to church regularly, because it takes a LONG TIME for them to really learn to honor their parents, love their neighbor, live modestly, save some of their money, refrain from drinking, etc etc, and yes all these things ARE taught in Sunday school.
Then just carefully point out how many times they hear that old devils advertisment for soft drinks that rot out their teeth, etc, without preaching about it. They WILL understand that the government really ought to do something about advertisements aimed at kids that are designed to entice the kids into adopting bad habits.
It blows me away that most environmental activists don’t seem to know shit from apple butter when it comes to talking to people who are NOT YET SAVED, to make a Christian pun about it. Eighty to ninety percent of everything I read in the msm is geared to the people who are already on board, namely the well educated liberalish leaning reader, when it comes to environmental activism. Half of what I read appears to be written by fucking IDIOTS determined to sabotage their own cause by way of insulting the very people they most need to connect with. They just can’t refrain from making at least ONE condescending nose in the air remark about the people who go to church, or vote R, or work in industries they would like to see shut down, etc.
EXTREME ARCTIC MELT IS RAISING SEA LEVEL RISE THREAT; NEW ESTIMATE NEARLY TWICE IPCC’S
“Trajectory of dramatic climate change in the Arctic is locked in through 2050, but what happens after that depends largely on our choices today…Global sea level rise could happen at nearly twice the rate previously projected by the U.N. Intergovernmental Panel on Climate Change, even under the best scenario, according to a new report…
“The trajectory of dramatic climate change in the Arctic is locked in through the middle of the century, when the region is expected to see temperatures at least four degrees Celsius above late 20th century averages. But what happens after that—whether the Arctic’s average temperature climbs to 6 degrees C above average or rockets to twice that—depends largely on us, the report says.
“If the goals of the Paris agreement are met, end-of-century sea level rise would be reduced by 43 percent—or more than 20 centimeters—compared with a business-as-usual scenario, according to the report. It would also stabilize temperatures over the Arctic Ocean in winter at 5-9 degrees C above the 1986-2005 average..
The report includes the work of more than 90 scientists from around the world, and was peer-reviewed by 28 experts. It mostly covers the period of 2011-2015, with some observations from 2016 and early 2017… One of the challenges in creating a comprehensive report about the Arctic, say some of its authors, is the pace of change there. “The problem is things change so quickly,” said Walter Meier, a scientist with the NASA Goddard Space Flight Center Cryospheric Sciences Laboratory who was an author of the report.
The report only includes peer-reviewed work, and the peer review process can take a year or more. “The report is almost out of date before it gets published.” That said, this work reflects most comprehensive look to date at the science of the changing Arctic and its future.
https://insideclimatenews.org/news/25042017/arctic-sea-ice-climate-change-global-warming-sea-level-rise-ipcc
One more case of reiterative mass re-agreement asymptotically approaching a consensus of conditions in a linear fashion to estimate a non-linear system. We can call this the Tantalus System, with reality always out of reach.
Roger Boyd
http://www.humanitystest.com/why-greenhouse-gas-emissions-did-not-really-stabilize-in-the-past-few-years/
Toyota has been showing of a hydrogen fuel cell big rig that it has developed and will be testing at the port of LA. They have a 27 second split frame video comparing the acceleration to that of a conventional diesel rig. I’m just wondering what anybody who has operated a truck of this size thinks the driving dynamics will be like. My guess is that it will be a much more pleasant vehicle to operate in terms of noise, vibration and lack of gear shifting. Economics and range of course, are a whole other ballgame. Any thoughts?
https://www.youtube.com/watch?v=pdbT4HjzTdk
Fuel cell vehicles are basically electric vehicles, with an onboard generator fueled by H2. Almost all diesel trains are the same thing, except with diesel motors instead of fuel cells – diesels don’t have enough torque at low speeds.
If the electric motor is properly sized it will be very smooth and powerful. Like trains.
I prefer Wrightspeed’s serial hybrid heavy-duty truck drive train, with a multi-fueled gas turbine engine-generator. It can burn diesel. It can burn propane. It can burn natural gas where CNG is available. It has the high-torque, electric drive, regen braking, etc. of Toyota’s fuel cell truck without the hydrogen connection and expensive fuel cell stacks.
It is really optimized for work-horse trucks with a lot of stop/start, hill-climbing, like dump trucks, delivery, trash collection, etc. Not sure if it works was well in a highway big-rig freight hauler configuration.
http://www.wrightspeed.com/
Wrightspeed sounds like an excellent powertrain. Their website is pretty shy on specifics, so I suppose they are still very early in their rollout of the product and finding customers.
I realize that I parked my car on the street outside their headquarters this January.
Power to them.
April 24, 2017
CO2 410.07 ppm
https://scripps.ucsd.edu/programs/keelingcurve/
I do wonder how global CO2 levels can do other than rise. More coal and natural gas power plants are being built around the world. Southeast Asia is a particular case where coal plants are being built and planned.
Southeast Asia is planning 400 new coal power plants — what does that mean?
http://energydesk.greenpeace.org/2017/01/13/southeast-asia-coal-plans-health-japan-indonesia/
Global coal and natural gas planning.
https://www.oilandgas360.com/new-power-generation-coal-still-the-dominant-fuel/
Here is a comprehensive study of solar power potential in Vietnam.
MAPS OF SOLAR RESOURCE AND POTENTIAL IN VIETNAM
http://dattech.com.vn/Content/uploads/files/Maps%20of%20Solar%20Resource%20and%20Potential%20in%20Vietnam%20REPORT%20FOR%20PUBLISHING.pdf
Note the low insolation values in the north during certain months, probably due to monsoon activity. Areas in the north of Vietnam have half the insolation of 40N in January east coast USA.
Coal and more coal for Asia.
https://www.bloomberg.com/news/articles/2016-11-02/asia-s-coal-addiction-seen-growing-despite-promises-on-climate
The age of plenty on steroids (with charts)
There are plenty of reasons to be alarmed about the future, given not only the increasingly imminent danger of Climate Change, but also the rise of new xenophobic regimes and policies in the United States and Europe. Not to mention a new U.S. Administration that has appointed directors of federal agencies who were hand-picked by the fossil fuel industry and openly deny the scientific consensus on man-made Climate Change.
Today Michael Liebreich, the founder of Bloomberg New Energy Finance (BNEF), provided a potent counter-narrative to attendees at the BNEF Future of Energy Summit in New York City. Liebreich echoes the conclusions of many clean energy analysts, noting that despite what has been described as a “wave of Populism on both sides of the Atlantic”, that the future of solar, wind, and electric vehicle markets are very strong.
As usual, Liebreich’s thesis was soundly backed by figures. Prominently, he noted falling costs for wind and solar, with the price of solar reaching a new record low $26.7 per megawatt-hour (MWh) in Mexico. And this is hardly limited to solar – Liebrich notes new record low prices for wind, with even offshore wind reaching a new record low of $49/MWh and merchant offshore wind in Europe. Similarly gas and oil prices remain very low, which led Liebreich to update his description from last year’s presentation of an “Age of Plenty” to the “Age of Plenty on Steroids”. This means cheap, abundant energy, and increasing portion of which comes from zero-carbon renewable energy sources.
Nor did Liebreich appear to be phased by the Trump Administration and its “strange fetish for coal”. Indeed, he welcomed attendees to his talk as “fellow members of the Climate Industrial Complex”, a phrase from Myron Ebell’s rather paranoid interview from the previous day. Additionally, in a series of slides clearly showed how it was automation and a shift to gas that has decimated coal employment.
Somebody (OFM?) posted a link to a documentary among the comments here recently, in which this Liebreich guy features prominently but I haven’t been able to find the comment so it might be less recent than I thought. IMO his thoughts fit well with much of the discussion going on in this thread (at least the parts not dealing with religion/global warming denial).
With Asia building more coal plants, US and Europe as well as other areas building more natural gas plants, I don’t see how any global agreement to limit GHG’s can actually be achieved. Many countries have not really started their build out of renewable energy since coal is still abundant in many regions. Where natural gas is not abundant it often can be imported.
The Saudis are talking a big game, but have far less solar PV than the small state of New Jersey, USA.
Hi GF,
You’ve got a point hard to argue with, the Saudis talk a lot, but so far they haven’t actually done much when it comes to wind and solar power.
But considering their internal political situation, and practical considerations, it’s easy to see why. Changing course isn’t easy, politically, when every body is attached to the oil teat like little piglets latched onto their momma.
And as a practical matter, they have almost for sure made the right decision, in terms of dollars and cents in their overseas bank accounts, and gold in vaults, by delaying any large scale build out of wind and solar power infrastructure.
I’m a big advocate of everybody else who has the money to do so going renewable as fast as possible, for all the usual reasons.
But I don’t need a CPA or even a spreadsheet to understand that it’s not in my own personal best interests to lay out ten or twenty grand for a solar system. There are other things I can do that will reduce my purchased energy consumption at lower costs, such as trading up to a newer truck, installing a heat pump, etc. I’m waiting for solar panels, inverters and so forth to get even cheaper, lol.
The Suadis have a lot of well educated and competent financial people, and there is little doubt they have recommended putting off the investment due to the cost of wind and solar power falling so fast that delaying the investment is a no brainer, in terms of managing the country’s ( aka the royal family’s) money.
Maybe the Saudis think that investments elsewhere are paying off better than investing in solar power. They may be realists.
I wonder if a realistic assessment of solar potential in Saudi Arabia has been done.
As far as Asia goes, it is strongly investing in coal. Also growth in natural gas power generation.
http://energydesk.greenpeace.org/2017/01/13/southeast-asia-coal-plans-health-japan-indonesia/
Here is what a solar assessment looks like. In this case for Vietnam. Notice that during certain months parts of north Vietnam have very low solar insolation. Probably monsoon related.
http://dattech.com.vn/Content/uploads/files/Maps%20of%20Solar%20Resource%20and%20Potential%20in%20Vietnam%20REPORT%20FOR%20PUBLISHING.pdf
From Bloomberg “Climate Promises Can’t Kill Asia’s Coal Addiction”
https://www.bloomberg.com/news/articles/2016-11-02/asia-s-coal-addiction-seen-growing-despite-promises-on-climate
I think that is one of the big risks with promoting EV cars first – if oil suddenly jumps in price and they take off then the easiest thing to switch to for power might be more coal. Although there will be, and are, other limitations – there was a report in the UK last week that indicated in some areas here if just six cars in a street plugged in to recharge at the wrong time the local substation would fail.
Hi George,
I’ve often pointed out in the past that electrification of the agriculture industry is simply out of the question, out in the real boonies where farming really happens, because the rural grid isn’t up to the job, and the cost of upgrading it to handle charging huge batteries in large numbers FOR ONLY A FEW WEEKS SPRING AND FALL is more than anybody is willing to pay, at least for the foreseeable future.
I can’t see mobile farm equipment being electrified until after the price of diesel goes thru the roof, and even then, diesel will probably still be a lot cheaper, considering the capital investment needed to switch to battery power.
There’s a hell of difference between electrifying a car used a couple of hours a day, or less, year in and year out, just about every day, and a tractor that sits most days but runs up to twenty two hours ( two for refueling, maintenance, operator breaks ) during busy seasons. A CAR cruises on as little as fifteen or twenty horsepower, but a tractor in the field typically uses at least half the available engine power, and would discharge any given battery at double or triple the rate, or even faster, than a car cruising down the street.
Even here in the USA, it’s my impression that the grid is not up to the job of running reasonably fast chargers on the grand scale, due to a lack of transmission capacity over the last mile or two of neighborhood lines.
But the incentive for the power companies to upgrade is enormous. The managers are probably salivating like Pavlov’s dogs at the prospect of selling as much as twice or even three times as much juice to a given residential customer or small business, and the actual generating capacity seems to be there, if they can just get the juice delivered that last mile or two.
And when the utilities successfully sold the idea of the “total electric” house to homeowners, they had no problems upgrading the grid fast enough to keep up with customers who gave up oil and propane for heating and cooking.
Just about every new house built in my neck of the woods has a heat pump, and as old oil and propane furnaces wear out, heat pumps are taking their places. I haven’t heard a peep from anybody about problems with overloaded local lines.
So- My guess is that the utilities won’t have any trouble keeping up, unless for some reason electric cars start selling a LOT faster than anticipated.
Suppose something causes the price of oil to jump up past a hundred bucks and stay there. The only reason I can see that this might happen suddenly is a war that keeps tankers in port, but wars do have a way of happening.
The question could come down to whether the auto companies could build electric cars faster than the utilities could upgrade the last few miles of lines.
But while generating capacity is generally adequate for peak demand, in some places it’s already marginal, during extremely hot or extremely cold weather, and even the main transmission lines are often pretty much maxed out during extreme weather events.
Suppose every third or fourth homeowner wants to charge his car on a night when his local utility is already having problems due to high demand for heat…………
Hard core techno optimists are likely to argue that electric car owners can feed juice INTO the grid to help manage peak loads, and recharge during off peak hours, and under normal circumstances, this is at least technically possible.
But an electric car has to be ready to go for the owner to go to work, and in the event of more than one day or night of extreme weather………… car to grid isn’t going to work well, if it works at all.
Personally I think that it might be prudent to keep enough coal fired generating capacity available on a stand by basis to make sure we can and do get thru extreme weather events without blackouts. This would cost a good bit to be sure, considering that such standby coal plants would be used only a few days a year, but it would be better to pay the cost than to deal with blackouts.
And since such back up coal plants would run only a few days a year, there’s really no reason to get all religious about the air pollution associated with running them during extreme weather events.
China and India aren’t about to shut down domestic coal fired generation.
From Bloomberg “Climate Promises Can’t Kill Asia’s Coal Addiction”
Asia’s demand for coal is likely to increase for years to come even though countries including China, Japan and India have agreed on steps to limit fossil-fuel pollution damaging the climate.
https://www.bloomberg.com/news/articles/2016-11-02/asia-s-coal-addiction-seen-growing-despite-promises-on-climate
INDIA’S OUTSIZED COAL PLANS WOULD WIPE OUT PARIS CLIMATE GOALS
“India is facing a dilemma of its own making,” said UCI associate professor of Earth system science Steven Davis, co-author of a study published today in the American Geophysical Union journal Earth’s Future. “The country has vowed to curtail its use of fossil fuels in electricity generation, but it has also put itself on a path to building hundreds of coal-burning power plants to feed its growing industrial economy.”
https://www.sciencedaily.com/releases/2017/04/170425140207.htm
Four hundred coal plants planned for Southeast Asia.
http://energydesk.greenpeace.org/2017/01/13/southeast-asia-coal-plans-health-japan-indonesia/
Yep, and Southeast Asia has 400 coal plants planned.
Can’t seem to post the url. Having trouble posting at all.
It’s a great article so you can find it at the energy desk of Greenpeace written by Lauri Myllyvirta January 13 2017.
If we went to all electric vehicles and did not make them more efficient or add new sources of power generation we would use between 10 percent and 20 percent of summer generating capacity to keep EV’s charged.
Could end up being a a lot less in the long run since the fossil fuel industry would mostly cease to exist and all that electric power would no longer be needed. I think if all commercial, business and residential sites would switch to LED’s for lighting that would cover the rest. Commercial and industrial use 62% of the electric power in the US and commercial alone uses 35% compared to 37% for residential use.
Businesses are lighting and power heavy, they keep lights on day and night.
Add some insulation to reduce air conditioning use and we could power all the EV’s with no change in the system.
Just about every new house built in my neck of the woods has a heat pump, and as old oil and propane furnaces wear out, heat pumps are taking their places.
Are they air or ground heat pumps? I’m very curious about the latest air heat pumps.
Why does agriculture HAVE to use big batteries to be electrified?
We have center-pivot irrigation, why not center pivot tillage, planting, weeding, harvesting, mowing, raking, baling… etc… connected to the grid?
How about decentralizing agro and putting it around the home? Bring people to the food, instead of the food to the people? That seems even more efficient. And the plants could benefit from humans’ liquid and solid wastes too.
Caelan, it’s a fair question but unrealistic expectation. There are lots of reasons why. So let me touch a few.
Maybe the biggest reason is there are to many naysayer like Caelan in the western economy. I’m pretty sure you have criticized Nick many times for promoting EV’s. But the fact is, look how hard it is to inconvenience the public just to give up the idea of the gas station and plugging in there car. If you think a guy who works 40 to 50 hours a week and makes $75k. Wants to grow his own food, your kidding yourself. What he’s looking for when he gets home is his recliner and big screen.
Second, most people don’t have enough land around their home to even produce 10% of their required intake.
Yes, you wouldn’t have to bring the food to the person. But were I live, which is some of the richest soil and best climate anywhere. You would have to bring the water to the home. Here is an idea for you to help understand the difficulty of what your talking about. Go to Google Earth and follow the Colorado river from the Hoover Dam to the Gulf of California. Almost every drop of the dams release is used for agriculture. It’s just doesn’t get more efficient than this.
Who is going to pay for the education for the public to learn how to grow their garden? 90% of the people who live around me pay a gardener to mow their yard and half of the 10% that don’t are to lazy to even to do anything.
What I have found is the easiest realistic approach. Is to plant fruit trees around the home and mulch my yard waste to fertilize them. But, I’ll bet it doesn’t even supply 5 % of my needs, but it does supply quality tasting organic fruit for me.
Hi there, Wehappyfew
What is theoretically possible, and what is actually doable, in economic terms , are often two different things.
If frogs had wings, they could fly. If we were to have unlimited capital and unlimited skilled manpower, agriculture could be electrified.
Some progress will be made over the next decade or two in electrification of work currently done with diesel fuel, gasoline, propane, or natural gas fueling internal combustion engines.
And a hell of a lot of energy intensive work , such as plowing, has been already been partially eliminated by the adoption of no till technologies, by way of example.
Just extending enough high capacity transmission lines to the nation’s farms would cost more than anybody would even CONSIDER paying, under any circumstances, so long as any other option remains viable.
Diesel fuel at ten to twenty bucks a gallon will be far cheaper, and at that price, we will have either conventional or synthetic diesel fuel available at least for the foreseeable future.
Most people who aren’t in the industry simply don’t appreciate the way agriculture works, in respect to the calender. Farmers get very busy for a few weeks, mostly a couple of times a year, on commercial farms that are dedicated to producing staple foods or fiber. The rest of the time, we aren’t so busy, in terms of energy consumption.
Suppose you build a house, and want to pay for it by renting it out. That may work at the beach in the summertime, you can get as much as ten grand a week for a nice house on the beach. Ditto for a nice large house in an upscale ski resort during the winter.
But a house in an ordinary location…….. try paying for it renting it or living in it only sixty days out of the year, with it sitting empty the rest of the year.
Recovering the cost of electrifying the nation’s farms presents a similar problem.
We farmers are already adapted to the way things work NOW, and we don’t generally have any problems with energy supplies, because diesel fuel can be delivered ahead of need, and stockpiled, as necessary, on the farm itself, or in nearby tank farms. Even a dinky little farm such as mine generally has storage enough to run for a week or two during busy times, and all it takes to get a delivery of five hundred gallons, or five thousand, is a phone call a day or sometimes two days ahead.
There are no viable electricity storage options available for now, and there aren’t likely to be any that are affordable for quite some time, if ever, in terms of farm work.
A generation down the road……. farmers will be using a lot more electricity, and a lot less diesel fuel and propane, in relative terms.
It’s possible farm equipment will be running on alcohol, if alcohol proves to be cheaper, in the long term, than biodiesel.
There are already diesel engines in production that can run on up to ninety five percent ethanol and five percent or even less diesel fuel. They’re about twenty to twenty five percent more expensive than an ordinary diesel, but we can produce enough alcohol OR biodiesel to run our farms if we have to, here in the USA at least.
Or if it becomes necessary, the government can give farmers, cops, the military, electric utilities, etc, first dibs on whatever diesel fuel is available.
Having said all this, technological miracles have a way of happening, and it’s not totally out of the question that batteries will get to be cheap enough that farmers will be able to use them for quite a lot of day to day work.
A forty horsepower tractor used a couple of hours a day,day in, day out, distributing feed, or cleaning out barns, etc, could be electrified, using batteries available today, but I don’t expect to see any such tractors at local dealerships for another five or ten years. Most folks who follow the battery industry expect the cost of large batteries to come down by half within this time frame.
An eighty kilowatt hour battery would likely run such a tractor doing chore work at least three hours, maybe four hours, because the power demand is intermittent rather than steady.
Out in the field, you generally use at least half to two thirds and often every horsepower the engine can produce, on a continuous basis, and you would be heading back to the barn pdq for a recharge.
There once was a farmer who was raising 3 daughters on his own. He was very concerned about their well being and always did his best to watch out for them. As they entered their late teens the girls dated, and on this particular evening all three of his girls were going out on a date. This was the first time this had occurred. As was his custom, he would greet the young suitor at the door holding his shotgun, not to menace or threaten but merely to ensure that the young man knew who was boss.
The doorbell rang and the first of the boys arrived. Father answered the door and the lad said, “Hi, my name’s Joe, I’m here for Flo. We’re going to the show, is she ready to go?” The father looked him over and sent the kids on their way.
The next lad arrived and said, “My name’s Eddie, I’m here for Betty, we’re gonna get some spaghetti, is she ready?” Father felt this one was okay too, so off the two kids went.
The final young man arrived and the farmer opened the door. The boy started off, “Hi, my name’s Chuck… –” and the farmer shot him.
I agree.
A small quibble: if one were to electrify seasonal work, I imagine it would be done with swappable batteries, charged at regional depots. That would be much cheaper and more convenient than charging on-site.
In other words, seasonal farm-work electrification would not require a massive expansion of transmission and distribution.
Yair . . .
wehappyfew. I have such a system sitting in my yard . . . ran out of health, and money and patents required to bring it to the market but it does work
http://www.heavyequipmentforums.com/threads/new-electricaly-powered-vegetable-production-system.18156/
Cheers.
one of the big risks with promoting EV cars first – if oil suddenly jumps in price and they take off then the easiest thing to switch to for power might be more coal.
It’s not really a risk at all. A coal powered EV is roughly as good as an ICE, CO2-wise. And, EVs are synergistic with wind and solar: they can charge at night when wind and nuclear are often in surplus; charge during the mid-afternoon solar peak; and charge dynamically when wind is in surplus.
So, EVs promote and pave the way for wind, solar, and nuclear.
It’s certainly a risk – if coal can power the cars and is cheap why develop any of the alternatives?
If utilities decide that they like coal, we’re in trouble, I agree.
But what does that have to do with EVs?
If anything, a growth spurt in EVs would encourage utilities to go with wind and solar, given that EVs can schedule their charging around availability.
“If anything, a growth spurt in EVs would encourage utilities to go with wind and solar, given that EVs can schedule their charging around availability.
That gives me an idea. There might be a perfect storm a brewing.
Increasing penetration of low cost wind and solar cuts into thermal plant profits but, requires large amounts of rapid response from either supply side resources or demand response mechanisms.
Increasing numbers of EVs with V2G (vehicle to grid) capability are developed and brought to market. These V2G capable EVs eventually become an effective rapid response supply resource pool while, an increasingly large pool of EVs become an increasingly effective demand response mechanism.
The availability of EVs as both a supply and demand response resource, reduces the need for and use of thermal plants, further reducing their viability. I would not want to be a shareholder in an operator of thermal plants in such a scenario.
Absolutely.
The Demand Response side is here now. The V2G will take a little organizational development, but…not much.
Change is coming.
Are you suggesting utilities would install wind and solar at higher cost that fossil carbon because the power is being used to recharge EV’s? The operative word here is ‘cheaply’. The operative system is market capitalism. I’m not sure where you’re coming from in suggesting that costlier alternatives will be employed because EVs are present in demanding the E. It seems Panglossian to suggest that because the power demand is created by EVs that the utilities will willingly forfeit cheaper fossil carbon in favor of a more expensive alternative. Dream on. I’m sure natural gas will be beating out solar/wind for some time to come.
Are you suggesting utilities would install wind and solar at higher cost than fossil carbon
No, we’re not discussing fossil carbon. We’re discussing coal. George was worried that new demand for electricity from EVs would promote coal.
I’m sure natural gas will be beating out solar/wind for some time to come.
I think NG will beat coal, for sure. Solar/wind aren’t cheaper than NG right now, as far as I know. But…do you think NG will stay this cheap? A lot of people on this blog seem mighty skeptical.
I’m not sure where you’re coming from in suggesting that costlier alternatives will be employed because EVs are present in demanding the E.
Well, if intermittency and daily peaking problems don’t create any additional costs for solar/wind, that would be great. I hope that utilities use the cheapest solutions, like Demand Response (DSM), but they may be tempted to use familiar solutions, like NG generation. If so, that will raise costs.
EVs offer an incredibly, powerful, convenient form of DSM.
Again, wind/solar are already cheaper than coal. If NG rises in price, or if it’s charged a carbon tax, wind/solar will be substantially cheaper.
EVs would reduce the cost of wind/solar at high market penetrations, and would make it more competitive.
Hi Survivalist,
Natural gas is not competitive with wind and solar in areas such as Iowa (for wind) or Arizona (for solar) at a time when natural gas prices are historically low. As more natural gas is used in electric power it will deplete and output will peak and natural gas prices will rise, in the mean time the price of wind and solar power will continue to fall.
Perhaps natural gas will be cheaper than solar and wind in some areas for “some time”, but this will probably be less than 5 years, by 2022 we will see higher natural gas prices and there will be very little new construction of natural gas plants and older plants will start to be shut down as they will not be able to compete with cheaper wind and solar (newer plants will be used as backup where needed).
Hi George,
In many places coal is not very cheap, wind and solar are cheaper and can be backed up with nuclear and natural gas as well as overbuilding wind and solar and connecting areas to increase system reliability and reduce the need for backup. Electricity use can be reduced by better buidings (Passivehaus) and the use of heat pumps.
Right – so now’s the time to promote all that and let the EVs happen as they will.
Why? What negatives do you see from EVs? EVs reduce oil consumption, which is a good thing. The worst case scenario is that short term marginal electricity might come from coal. That scenario is no worse than oil for CO2, and it’s better for supply security concerns; , and that’s the worst case – most marginal power production would come from gas in the very short term. Then, wind and solar in the medium and long term.
Do you agree that EVs help support the growth of wind and solar?
EVs help increase the demand for E. The E will be generated by the mechanism that costs the least. I would have thought that was pretty obvious. EVs will increase demand for wind and solar when wind and solar are the cheapest supply.
Survi- “The E will be generated by the mechanism that costs the least. I would have thought that was pretty obvious.”
Well, that makes sense, but it is not true in many places, because of public policy. For example Germany installed lots of solar over the past decade even though they are pretty cloudy and coal was much cheaper. California has installed lots of solar even though coal or NG would have been cheaper, in order to achieve a high renewable goal.
There are many other places where such choices have been made on a fairly large scale. Texas shelved plans for many coal plants over the last decade, even though it would have been cheap electricity.
Think of it this way: solar/wind don’t have the costs of pollution, and insecurity of foreign supply.
Those costs are real.
Hi George,
All of it needs to happen. The focus on EVs is because many people expect that oil will be the first fossil fuel to peak, coal and natural gas will not be far behind and perhaps people will realize that if the economists were wrong about oil, maybe they are wrong about coal and natural gas as well (economists generally think that fossil fuels will either never peak or they will be on an undulating plateau for 50 years or more). I think the economists that think in these terms are dead wrong. Fossil fuels will peak, prices will rise and there will be great incentive to develop wind, solar, hydro, nuclear, zero energy homes, heat pumps, evs, light rail, electrified rail, better designed urban areas, more recycling, better access to birth control and education worldwide and probably a number of other things (HVDC grid).
“With Asia building more coal plants,”
China Suspends 104 Under-Construction & Planned Coal Power Projects
The use of coal in China has received heavy attention and criticism over the years, however in recent times China has begun cracking down on coal power plants and signalling heavy cuts. In October of last year, China halted construction on 30 coal power plants totaling 17 GW, ten of which were already under construction. In December, new research from China showed that China might be aiming to phase out coal imports altogether. China’s 13th Five Year Plan also committed to a coal capacity cap of 1,100 GW — though that still remained a sizable increase on the already 920 GW worth of coal the country has installed.
Nevertheless, analysis from Carbon Tracker Initiative (CTI) of China’s 13th Five Year Plan highlighted the possibility that the country was on the verge of wasting $490 billion on unnecessary coal plants. At the time of the report in November, 2016, CTI reported that China had 895 GW worth of operating coal capacity and another 205 GW of capacity under construction. The analysis found that there was a significant chance that up to 210 GW worth of coal capacity might be completely unnecessary in 2020, if things continued apace.
Bold mine.
I didn’t want post the complete PV Magazine article so I omitted quite a bit. Here’ some more from the PV magazine piece:
So Trump or no, the Energy Transition is happening faster than anyone expected. Liebreich notes that 2016 was another year where economies grew in Western nations like the United States, but that emissions did not. This is happening as the United States moved from 3% non-hydro renewable energy to 9% from 2006-2016, while China moved from 6% o 10%, and a number of European nations reached 25% or more non-hydro renewable energy penetration.
This rapid progress is accompanied by high spot penetrations of wind and solar and is driving down capacity factors at thermal generation. As such it is driving new concerns, and the issue of grid integration of high penetrations of renewable energy is no longer an academic exercise.
Liebreich dove into some of these issues in his presentation, noting that even huge storage will be overwhelmed by the variability of wind. That means it will be practically impossible to get rid of all fossil fuel use. He also notes that the massive volatility of very high wind and solar penetrations will mean enormous ramp rates. It will also require robust interconnections between grids.
All of this is pretty standard for the large number of studies that have been produced to date regarding high penetrations of renewable energy. But what is more novel is that due to the success of wind and solar, we are having to deal with these issues in 2017, not 2025 or 2030.
Bold mine.
Call me an optimist but, it is my sincere hope that things do change faster than almost anybody expects (in terms of electricity generation and electrification of transport). There are signs that many players are about to be blindsided by massive increases in low cost solar PV generation.
In my neck of the woods, the local electric utility broke ground two weeks ago on a new power plant to replace some of their their ancient (inefficient, oil fired) base load capacity. It is planned to use NG, shipped as LNG and supplied by New Fortress Energy, who’s news page is all about their Jamaica deal (and nothing else). The plant is a 190 MW combined cycle gas turbine which is less than a third of the island’s peak demand. As these things go, it will probably consist of two gas turbines and one steam turbine, each of which will be about 10% of peak demand, satisfying the electricity grid rule of thumb that no single unit should be more than 10% of peak demand.
In an article covering the subject a local contributor looks at the prospects for low cost electricity going forward. A comment in the comments section does a very quick and dirty look at the financials and the future prospects for the profitability of this plant, for which ground was broken on April 7, look very dicey. In many places around the world solar and wind are putting caps on electricity prices, threatening the viability of existing thermal plants. Unless something happens to stop solar in it’s tracks, it’s only going to get worse, much worse. Good luck with that if you’re in the business of generating electricity with fossil fuels!
As a stand alone system, PV and wind can produce low cost power. If one adds in the cost of backup and storage to smooth out and fill in the intermittent nature, the costs will be similar to other production types.
What is needed is for the users to not only become more efficient but for them to provide some storage and peak production usage. If producers would become more flexible in their charge rates, residences and businesses could install systems to use excess capacity if the rates were low enough. Right now though just the delivery charge is a large portion of the cost and that needs to go down or the system will not work. Power rates would have to be real time adjustable also.
California, USA – April 17, 2017 – GE (NYSE: GE) and Southern California Edison (SCE), an Edison International (NYSE: EIX) company today unveiled the world’s first battery-gas turbine hybrid system in Norwalk, California. This is the first of two units that GE has delivered for SCE only months after announcing initial deployment plans of this innovative technology.
This system, called the LM6000 Hybrid Electric Gas Turbine (Hybrid EGT)* supports SCE’s increasing renewable energy capacity by providing quick start, fast ramping capabilities when they are needed. The unit integrates a 10 MW/ 4.3 MWh battery energy storage system capable of immediately providing power with GE’s proven 50MW LM6000 aeroderivative gas turbine.
http://www.genewsroom.com/press-releases/ge-and-southern-california-edison-debut-world%E2%80%99s-first-battery-gas-turbine-hybrid
Power company AES Corp. may soon win approval for a 300-megawatt battery facility that would be capable of storing more electrical power than any such facility previously constructed.
“It is the largest that we know of in the world,” AES Southland President Jennifer Didlo said.
http://www.presstelegram.com/business/20161129/aes-proposing-to-build-largest-battery-facility-in-the-world-in-long-beach
I believe in free markets, about as much as anybody, when free markets actually exist, but in most industries, the biggest players have gotten so big the very term free market is more or less a joke.
I maintain that while government should be kept as small as possible, it still needs to be big enough to deal with problems that can only be dealt with at the governmental level, such as pollution , public health, etc.
The health care industry routinely subjects people to some pretty rough involuntary sex without benefit of a lubricant, and this is not going to change, unless it’s changed by way of government intervening, and the adoption of a new model health care system, hopefully one patterned after the systems in use in countries such as Canada, Germany, France……
https://www.statnews.com/2017/04/20/steve-berman-drug-prices/
I have a couple of friends who have been royally screwed by the folks who control the market for insulin.
Stat’s a really good place to go for news about the health care industry.
Most of us ought to have it bookmarked.
Good paper for anyone following Arctic climate change science:
THE IMPACT OF CLOUD FEEDBACKS ON ARCTIC CLIMATE UNDER GREENHOUSE FORCING
http://journals.ametsoc.org/doi/full/10.1175/1520-0442(2004)017%3C0603:TIOCFO%3E2.0.CO;2
it is changing too fast to follow.
“it is changing too fast to follow” I agree, and so do most climate scientists, however, for those interested, Sam Carana, among others, does a good job of presenting latest information in a digestible form: http://acric-news.blogspot.ca/
Yes, that’s a good resource, but here is the correct link (typo above):
http://arctic-news.blogspot.com/
another very good resource:
http://neven1.typepad.com/
and you can follow the link to the arctic sea ice forum from there for more detailed discussion.
http://forum.arctic-sea-ice.net/index.php
Do I understand this correctly – the cloud feedback contributes 33% of the warming overall and 40% in the Arctic? And, although not explicitly stated, does this therefore lead to, respectively, 50% and 66% more warming than current models, which don’t include the the cloud feedback, are indicating?
I found out something else I didn’t know about the Arctic Ocean last week – although accounting for only 3% of water surface it accounts for 5 to 14% of CO2 absorption in the oceans (I don’t know why such a wide range). It was once thought that as the ice shrinks and more surface is exposed this would increase, but that has barely happened. Latest thought is that the limiting step is equilibrium levels in the water (i.e. “the Arctic is full”), and these could decline as the temperature increases, so it would become less efficient; or even a net emitter until a new equilibrium was established.
The higher rate of absorption of CO2 in Arctic waters is due to the lower temperature of the water. The colder the water, the more dissolved gases it can hold, and the cold water tend to sink, so there is a continuous supply of warmer water at the surface in contact with the air that is not yet saturated with CO2.
There are other factors in play as well, but this is the basic chemistry involved.
The warmer water at the surface or near surface comes up with currents flowing north, mostly.
The details beyond this point are over my head, since I haven’t any formal instruction in oceanography.
If anybody can recommend a favorite book on the subject, one interesting to read, not a text book, thanks in advance.
Yes – something to do with buffer solutions, I think calcium ions are important and their concentration can determine the rate somehow (which therefore tends to stay constant even if the pH changes) – that may be completely wrong though. I think David Archer at RealClimate is an expert in all that.
Hi George,
I’ve been trying to get a handle on the cloud problem as well. You might be interested in: CLOUD FEEDBACKS IN THE CLIMATE SYSTEM: A CRITICAL REVIEW by Graeme Stephens
http://journals.ametsoc.org/doi/full/10.1175/JCLI-3243.1 :
It seems that although progress in understanding the cloud feedback problem has been slow and confused by past analysis, there are reasons that give hope for real progress in the future.
Thanks, it looks easier to follow than some papers, I’ll still have to go through it a couple of times though (or these days more than that). Things have moved on fairly quickly since 2005, especially recently. There’s a youtube lecture: “Climate change morphing into an existential problem” with Prof Veerabhadran Ramanathan (I think if I post the link it might get embedded so I’ll leave it to Google). He is one of the father’s of global climate modelling. One of the reasons mentioned for the ‘morphing’, is the changes in results from cloud modelling (not in much detail but he looks particularly worried then) and the consequent impact on longer term warming. He tries to be positive, but not too successfully to my eye.
From what I can see almost all new studies show that what used to be unknowns in cloud modelling are now turning out to be fast positive feedbacks, and mostly stronger at the high end of expectations. I think there is still a bit of unknown about low level cloud reflections, but I’ve seen nothing saying this is definitely negative.
In some cases in the past ‘unknown’ was used to cover ‘too difficult’, (i.e. clouds need fine grain modelling for which computers weren’t sufficiently powerful, plus there was not much data to tune the models against). So I suspect that some of these findings might not have been so unexpected – it’s just that scientists didn’t really have enough hard evidence to back up their theories – but they knew where to look when the computational power became available, and hence the number of papers suddenly appearing.
‘Existential’ is used a lot but is too benign to express the issue very well, at first glance it almost conveys the opposite of what is meant, and even sounds nice when you say it, ‘Human extinction’ get’s more attention, but attracts all the trolls.
Hi George,
A lot is included in current models see
https://pubs.giss.nasa.gov/abs/sc02500z.html
https://pubs.giss.nasa.gov/abs/mi08910y.html
https://pubs.giss.nasa.gov/abs/na08200a.html
or the following page which lists more papers on GISS Model E2 (CMIP5) and Model E(CMIP3)
https://www.giss.nasa.gov/tools/modelE/
FAKE NEWS THREATENS A CLIMATE LITERATE WORLD:
https://www.nature.com/articles/ncomms15460
“One route to knowledge empowerment is the wider dissemination of scientific information. UNESCO believes that open access to scientific literature is fundamental for scientific discovery, innovation and socio-economic development, and have highlighted it as key for realizing the majority of the 2030 sustainable development goals (http://www.unesco.org/new/en/communication-and-information/access-to-knowledge/open-access-to-scientific-information/). These sentiments are very much shared by the editorial team here at Nature Communications—all our articles have been freely available since January 2016 and are published under the least restrictive creative commons licence, allowing maximum re-use. However, is the provision of knowledge enough, particularly given the proliferation of misinformation in the modern-day culture of fake news?”
Fake news, or as we used to call it- propaganda.
https://www.washingtonpost.com/opinions/trumps-greatest-single-achievement-almost-never-gets-mentioned/2017/04/26/6465447e-2aab-11e7-b605-33413c691853_story.html?utm_term=.f4a4f5f1ddfe
Good morning Trumpster
Donald Trump’s Tax Plan Would Turn the Whole U.S. Into Kansas
This raises the obvious concern that the White House is simply planning a massive, backdoor tax cut for the rich. The current top individual income tax rate is 39.6 percent. Trump would bump it down to 35 percent. Letting law-firm and private-equity partners pay a 15 percent rate on their profits, which often make up the vast majority of their pay, would significantly lower their IRS bills. Trump’s team insists that this won’t happen; today, Mnuchin said Wednesday that the new 15 percent rate will be limited to small and medium-sized businesses. It’s not clear, however, what would count as “medium,” or how Washington would enforce the rule.
http://www.slate.com/blogs/moneybox/2017/04/26/donald_trump_s_tax_plan_would_turn_the_whole_u_s_into_kansas.html
“Donald Trump’s Tax Plan Would Turn the Whole U.S. Into Kansas”
That’s one of the requirements for becoming the worst ever. In related news, add this to the “Best First 100 Days Ever” list.
Economy slows dramatically, growing a feeble 0.7% in Q1
The nation’s gross domestic product – the value of all goods and services produced in the U.S. — increased at a seasonally adjusted annual rate of 0.7%, the Commerce Department said Friday, below the tepid 2.1% pace clocked both in the fourth quarter and as an average throughout the nearly eight-year-old recovery. Economists expected a 1% increase in output, according to a Bloomberg survey.
https://www.usatoday.com/story/money/2017/04/28/economy-posted-feeble-growth-q1/100995626/
Trumpsters sez the D’s made it easy for us to mop up again.
He sez even the Huffing and Puffing Post gets it.
http://www.huffingtonpost.com/entry/obama-wall-street-speech-400k_us_5900bf16e4b0af6d718ab7b9
The first two paragraphs:
The rumors are true: Former President Barack Obama will receive $400,000 to speak at a health care conference organized by the Wall Street firm Cantor Fitzgerald.
It should not be a surprise. This unseemly and unnecessary cash-in fits a pattern of bad behavior involving the financial sector, one that spans Obama’s entire presidency. That governing failure convinced millions of his onetime supporters that the president and his party were not, in fact, playing for their team, and helped pave the way for President Donald Trump. Obama’s Wall Street payday will confirm for many what they have long suspected: that the Democratic Party is managed by out-of-touch elites who do not understand or care about the concerns of ordinary Americans. It’s hard to fault those who come to this conclusion.
Obama refused to prosecute the rampant fraud behind the 2008 Wall Street collapse, despite inking multibillion-dollar settlement after multibillion-dollar settlement with major firms over misconduct ranging from foreclosure fraud to rigging energy markets to tax evasion. In some cases, big banks even pleaded guilty to felonies, but Obama’s Justice Department allowed actual human bankers to ride into the sunset. Early in his presidency, Obama vowed to spend up to $100 billion to help struggling families avert foreclosure. Instead, the administration converted the relief plan into a slush fund for big banks, as top traders at bailed-out firms were allowed to collect six-figure bonuses on the taxpayers’ dime.
xxxx
Trumpster sez, the more you read of it, the easier it is to understand WHY so many people voted for Trump , a hell of a lot of them people who voted for Obama the previous time around.
Trumpster sez R types expect and approve or at least don’t give a hoot about this sort of thing, and neither do R Lite D’s who are mostly as happy as a pig in shit to go along with us, cause , hey in the last analysis, it’s mostly about the money , and getting more of it, and D Lite D’s, the kind that own the D party in recent times, hey they got plenty of money.
Trumpster goes on to say that for some reason, the D voters who don’t have a whole lot of money in the stock market seem to think their leaders ought not be for sale, especially not right out in the wide open like this.
Well, us R types,us Trumpsters, at least we got sense enuf to PRETEND we give a shit about such people, right prior to elections, anyway. Last time around , the D’s didn’t even have sense enough to pretend, and that put us over the top.
Here’s how many people have to pay the estate tax that Trump wants to dump
The estate tax (which famed conservative wordsmith Frank Luntz figured would be less popular if framed as a tax on death) applies an additional tax to those who die with an estate worth more than $5.49 million, the exemption per individual for 2017. It’s one of the more progressive parts of the tax code, aimed in part at reducing the extent to which families can amass huge wealth over time. Which by itself perhaps explains why President Trump isn’t a fan.
How much this would affect Trump and his family isn’t clear, because the president never released his tax returns. But it seems pretty clear that, whatever the net effect would be for the Trumps, a repeal of this tax would be a positive one for them.
https://www.washingtonpost.com/news/politics/wp/2017/04/26/heres-how-many-people-have-to-pay-the-estate-tax-that-trump-wants-to-dump/?utm_term=.f6241434f6e7
OFM says thankya HB
For the help pointing out what’s wrong with the Trumpsters.
You may never get it, I don’t suppose you will, but I believe the only real hope we have for BETTER government going forward is for the PEOPLE of this country, as opposed to the VERY WELL TO DO D LITE FACTION, to regain control of the Democratic party.
Having said this much, there is some real need to reform the tax code, although any changes made by the R’s will for dead sure be targeted at leaving more in the pockets of R’s and D Lites, and you my friend ARE a self identified D Lite, and have just very recently said you are very much in favor of paying trivial capital gains taxes on your hoped for killing in the stock market.
It may not have occurred to you, but your LOW rate must be offset by a high rate paid by people who work by the hour or on salary, or as the owners of small businesses.
Real reform, GOOD reform, would involve raising the standard deductions for wage workers who can’t itemize.
Inflation has been raising their tax bill, in real terms, for a long time.
There MIGHT be a token effort made by the Trumpsters along this line, as a smoke screen , I wouldn’t be too surprised by something in the line of a crumb for the people, and the loaf for the elite.
Hi OldMacDonald aka KGB Trumpster,
“You may never get it”
Actually, I do have it and you don’t. That’s why I understand the tax code for capital gains and you don’t.
“Inflation has been raising their tax bill, in real terms, for a long time”
Wrong, the standard deduction is inflation adjusted annually.
“your LOW rate”
The tax rate is the same for you and myself. The difference is that during my career I accumulated income achieving assets and you are still living with daddy(in the basement I presume). Waiting for your inheritance like the freeloader you are. You just seem jealous of other peoples success in the context of your own personal financial failure.
Something interesting from the CO2 capture side of things.
http://pubs.rsc.org/en/content/articlelanding/2017/ta/c7ta00437k#!divAbstract
From the journal:
Journal of Materials Chemistry A
Systematic variation of the optical bandgap in titanium based isoreticular metal–organic frameworks for photocatalytic reduction of CO2 under blue light
Matthew W. Logan,a Suliman Ayad,b Jeremy D. Adamson,a Tristan Dilbeck,b Kenneth Hansonb and Fernando J. Uribe-Romo*a
Author affiliations
Abstract
A series of metal–organic frameworks isoreticular to MIL-125-NH2 were prepared, where the 2-amino-terephthalate organic links feature N-alkyl groups of increasing chain length (from methyl to heptyl) and varying connectivity (primary and secondary). The prepared materials display reduced optical bandgaps correlated with the inductive donor ability of the alkyl substituent as well as high photocatalytic activity towards the reduction of carbon dioxide under blue illumination operating over 120 h. Secondary N-alkyl substitution (isopropyl, cyclopentyl and cyclohexyl) exhibits larger apparent quantum yields than the primary N-alkyl analogs directly related to their longer lived excited-state lifetime. In particular, MIL-125-NHCyp (Cyp = cyclopentyl) exhibits a small bandgap (Eg = 2.30 eV), a long-lived excited-state (τ = 68.8 ns) and a larger apparent quantum yield (Φapp = 1.80%) compared to the parent MIL-125-NH2 (Eg = 2.56 eV, Φapp = 0.31%, τ = 12.8 ns), making it a promising candidate for the next generation of photocatalysts for solar fuel production based on earth-abundant elements.
So what will we do with gigatons of formic acid?
I am waiting for a self replicating system that uses CO2 to build itself then converts the CO2 to oligomers of cellulose.
So what will we do with gigatons of formic acid?
Dunno, I’m sure we can find some use for it…
http://www.windenergy.basf.com/group/corporate/wind-energy/en/brand/FORMIC_ACID
What are the applications for formic acid?
Formic acid is an efficient and environmentally friendly organic acid for many applications. In leather processing, the acid is used in tanning and dye fixing and serves also as a neutralizing agent and pH adjuster in many steps of textile processing. In the production of epoxidized soy bean oil formic acid is used in combination with hydrogen peroxide as oxidizing agent. In home care, industrial and institutional cleaning, formic acid is a powerful descaler as well as a valuable biocide in many cleaning applications under the Protectol FM brand. It is also used to adjust pH values in flue gas desulfurization, latex coagulation and other applications. Formic acid can serve as a hydride donor in various chemical processes. In animal nutrition the acid preserves feed and silage. In oil field applications it helps to dissolve calcium carbonate. Potassium formate, a salt of formic acid, also helps with well drilling and completion in the oil field industry. Furthermore, potassium formate is environmentally friendly and at the same time a highly efficient deicing agent for roads and airport runways. As it is readily biodegradable, it protects the environment. The pharmaceutical industry uses formic acid in the production of various active pharmaceutical ingredients.</I?
Re:
I am waiting for a self replicating system that uses CO2 to build itself then converts the CO2 to oligomers of cellulose.
Well, we already have many self replicating systems that use CO2 to build themselves, such as bamboo. 😉
With a little extra help we can certainly obtain oligomers of cellulose from that.
https://biotechnologyforbiofuels.biomedcentral.com/articles/10.1186/s13068-017-0723-2
Abstract
Bamboo is a highly abundant source of biomass which is underutilized despite having a chemical composition and fiber structure similar as wood. The main challenge for the industrial processing of bamboo is the high level of silica, which forms water-insoluble precipitates negetively affecting the process systems. A cost-competitive and eco-friendly scheme for the production of high-purity dissolving grade pulp from bamboo not only requires a process for silica removal, but also needs to fully utilize all of the materials dissolved in the process which includes lignin, and cellulosic and hemicellulosic sugars as well as the silica. Many investigations have been carried out to resolve the silica issue, but none of them has led to a commercial process. In this work, alkaline pretreatment of bamboo was conducted to extract silica prior to pulping process. The silica-free substrate was used to produce high-grade dissolving pulp. The dissolved silica, lignin, hemicellulosic sugars, and degraded cellulose in the spent liquors obtained from alkaline pretreatment and pulping process were recovered for providing high-value bio-based chemicals and fuel.
Who knows maybe we can bioengineer some organism to do the whole the whole process in one fell swoop. Maybe give Craig Venter and George Church a shout.
We already have goats that produce spider silk so why the heck not, eh?
Good morning Fred,
I’ve long been impressed with the use of bamboo as a building material, but there’s never been enough of it nearby, and large enough for me to experiment with it, although it will grow to six inches diameter and fifty feet high in this area, at least, I have seen it that big.
How long does it last if you build a farm shed out of it, with a roof that keeps the rain off of it? I’m also intrigued by the possibility of using it as pipe in a jury rigged irrigation system, which would involve being in a high humidity streamside environment even when not in actual use. How long will a large section last before you could hit it with a hammer and smash or penetrate it, just lying around on the ground, in Florida?
Do you know of any research involving treating it chemically to make it last a long time, something akin to the processes used to manufacture pressure treated lumber?
There is always a possibility breeders can come up with strains that are extra thick walled and therefore even stronger, and more decay resistant as well.
Do you know of any research involving treating it chemically to make it last a long time, something akin to the processes used to manufacture pressure treated lumber?
Yes there is lots of research, but I need to look in my archives to provide you with some links and translations. I’m a long time member of a Brazilian bamboo forum.
My cousins have a farm in Brazil and they have giant bamboo on it and have a stream with a water wheel and a bamboo irrigation system set up.
It has been working for over 30 years.
In any case here is a general overview of preservation techniques:
https://www.guaduabamboo.com/preservation/chemical-bamboo-preservation
Bamboo is a wonderful building material that has been used for centuries. There are some modern architects who have been doing some great things with it. Simon Velez is one. I have a well worn dogeared copy of his book ‘Grow Your Own House’.
Here’s a link to some of his work.
https://www.dezeen.com/2014/07/21/simon-velez-giant-bamboo-architecture-domaine-de-boisbuchet-interview/
Here’s a great TED talk as well.
Elora Hardy:
Magical houses, made of bamboo
TED2015 · 10:17 · Filmed Mar 2015
https://www.ted.com/talks/elora_hardy_magical_houses_made_of_bamboo
Nothing against this research, but regarding the “CO2 capture side of things ” comment, I would be more optimistic if they demonstrated photocatalytic reduction at atmospheric levels of carbon dioxide. In other words, you still have to fight the laws of entropy.
To be fair, I wasn’t exactly touting this as a solution to the problem of recapturing CO2 from the atmosphere. Just some interesting research, that’s all.
There was some mention in the news recently of a discovery of some moth caterpillars that can digest plastic! I wouldn’t suggest using them as a solution to the problem of plastic in the environment either… They also eat beeswax and would probably do a lot more harm to bee populations before they ever put a dent in plastic pollution… Still, also interesting!
Cheers!
Why am I reminded of maybe an old Charlie Chaplin film, where he’s trying to stop/fix something somewhere, when some problem elsewhere opens up and so he attends to that and then that problem, or its ‘fix’, spawns another, ad infinitum?
The thing is, Fred, there’re a lot of oohs and aahs to be had in the promises from the world of so-called/crony-capitalist-plutarchy-derived science and technology, until its delivery.
Then there are a lot of ‘Oh shits! and ‘Ah fucks!’.
Your comments about technology and science are often somewhat reminiscent of a kid’s.
Your comments about technology and science are often somewhat reminiscent of a kid’s.
LOL! Says the village idiot who believes permaculture and anarchists living in hippie communes are a model that will scale globally to save the world and to top it off constantly repeats this kind of extreme naïveté…
The thing is, Fred, there’re a lot of oohs and aahs to be had in the promises from the world of so-called/crony-capitalist-plutarchy-derived science and technology, until its delivery.
Then there are a lot of ‘Oh shits! and ‘Ah fucks!’.
Really now?! No shit, Sherlock!
You have to be an absolute moron of the highest order to interpret any of my posts as promises of any sort! Let alone, imply that I am not aware of the law of unintended consequences of any technological development.
Technology is neither good or evil.
Guess what, both Denmark and North Korea have trains. Same technology, vastly different societies.
Only that’s not exactly true, despite your impressive lowbrow comment and mindless mantra, which I’ve come to expect.
And as someone who seems to like to prance around in the flag of so-called technology and science, it’s wryly amusing as well.
Hence my previous comment.
Now, if you’ll excuse me, I am actually posting this from my life of leisure, with my jetpack on, soaring high above the pristine wilderness below, and will be landing shortly on my landing-pad at my home in my sparkling, elevated jewel-of-a-city, whose buildings are all connected by moving skywalks, space elevators and self-flying cars. (I do so love these imaginary-collapse blogs that we like to while away some of our idle time on, ay?)
I’ll leave you with a random selection, for your education. At what age, 65? Ah well, better late than never.
Values in Technology and Disclosive Computer Ethics
See also below
Hi Fred,
I wasn’t aware of moth caterpillars being able to digest plastic, but I have heard of a relatively recent discovery that certain species of fungi can biodegrade polyurethane:
http://aem.asm.org/content/77/17/6076.full
And as much as I hate to suggest the idea introducing a new species into the environment to solve a problem that mankind created, I do worry a lot about plastic pollution in the ocean. It photochemically breaks down to microscopic scale and gets taken up in food chain by plankton and continues to bioaccumulate as you move up the food chain. I have read that the blubber of whales and dolphins can be so contaminated (with PCBs, specifically) that it can be considered toxic waste!
http://us.whales.org/issues/marine-chemical-pollution
“In fact, the levels of PCBs that accumulate in the bodies of some whales, dolphins and porpoises are so high that under US law, they could meet the criteria for being defined as toxic waste.”
There is a great future in plastics! LOL
https://www.youtube.com/watch?v=PSxihhBzCjk
PCB’s are not plastics.
True! But they were used to make some plastic and rubber products.
PCBs belong to a broad family of man-made organic chemicals known as chlorinated hydrocarbons. PCBs were domestically manufactured from 1929 until manufacturing was banned in 1979. They have a range of toxicity and vary in consistency from thin, light-colored liquids to yellow or black waxy solids. Due to their non-flammability, chemical stability, high boiling point and electrical insulating properties, PCBs were used in hundreds of industrial and commercial applications including:
Electrical, heat transfer and hydraulic equipment
Plasticizers in paints, plastics and rubber products
Pigments, dyes and carbonless copy paper
Other industrial applications
Although no longer commercially produced in the United States, PCBs may be present in products and materials produced before the 1979 PCB ban. Products that may contain PCBs include:
•Transformers and capacitors
•Electrical equipment including voltage regulators, switches, re-closers, bushings, and electromagnets
•Oil used in motors and hydraulic systems
•Old electrical devices or appliances containing PCB capacitors
•Fluorescent light ballasts
•Cable insulation
•Thermal insulation material including fiberglass, felt, foam, and cork
•Adhesives and tapes
•Oil-based paint
•Caulking
•Plastics
•Carbonless copy paper
•Floor finish
Although very inert, they dissolve readily in fat allowing the buildup in the food chain.
Health effects:
http://www.clearwater.org/news/pcbhealth.html
Hi Gone Fishing,
Yes, I know that PCB’s aren’t plastics. My point was regarding bio-accumulation of man made chemicals through the food chain. Sorry if that wasn’t very clear!
This study is more relevant to plastic contamination (specifically):
https://www.ncbi.nlm.nih.gov/pmc/articles/PMC1240281/pdf/ehp0109-000399.pdf
“PBDEs have been
detected in various biotic samples such as
birds, seals, whales, and even in human
blood, adipose tissue, and breast milk.”
I’m with you about plastics in the ocean being a major problem!
In other news about cetaceans:
We are down to the last 30 Vaquitas…
How do we tackle the economic and cultural conundrums that lead to the extinction of species?
http://www.theverge.com/2017/1/4/14167738/navy-dolphins-military-save-vaquitas-endangered-porpoise
…According to a new report, there are less than 30 vaquitas left in the world. That means that half of the population has disappeared since the last survey in 2015 — and this alarming drop means they soon could be gone forever.
The vaquitas live in the slice of ocean called the Gulf of California that splits the Sonoran Desert in Mexico. Over the last two decades, they’ve been driven to near extinction — drowned by the gillnets that poachers use to catch a giant fish called the totoaba. The totoaba is also critically endangered and prized in China for its swim bladder used in traditional Chinese medicine, according to Ben Goldfarb for Environment 360.
The US and Mexican Navies as well as scientists in both countries have partnered up to use the Navy’s bottlenose dolphins to locate vaquitas, the San Diego Union-Tribune reports. The plan is to capture a few vaquitas, and keep them safe until the region is free from illegal fishing.
Traditional Chinese medicine is mostly unscientific superstition yet it leads to a perverse economic demand for totoaba swim bladders which in turn lead to the unintended consequence of drowning Vaquita dolphins!
BTW, even if they can save a few of those 30 remaining Vaquita dolphins that few members of any species creates a very narrow genetic bottleneck which does not bode well for the long term survival of the species.
Then again who knows maybe some of that evil genetic engineering with things like CRISPR and gene-drives from the world of the so-called/crony-capitalist-plutarchy-derived science and technology, could be used to bring these beautiful creatures back from the brink… because one thing is for sure the ignorant anti science anarchist luddites sure as hell won’t!
Hi again Fred,
Here’s hoping somebody is using CRISPR tech on bamboo, with thicker walls and greater decay resistance it would go from being a useful material to being a SUPERB material for rough construction work.
Reassuring to know that, as usual, others with potentially widely-differing values, (sociopathic, etc.?), and geographic locations will likely be making undemocratic decisions for their so-called technology that nevertheless impact us, our local communities and surrounding wildlife, etc..
“Exctinction? What extinction? We’ll just use our technology to fix that too.”
Hi Fred,
I hate to say this, but 30 remaining dolphins means this species is effectively extinct.
Here is some “economic and cultural conundrums that lead to the extinction of species” to the max:
http://www.latimes.com/world/asia/la-fg-south-china-sea-environment-20160713-snap-story.html
“Although some of the damage was caused by dredging and island-building, the majority was blamed on the giant-clam harvesting using propellers. McManus called the practice “more thoroughly damaging to marine life than anything he had seen in four decades of investigating coral reef degradation,” the tribunal noted. Many of the clam shells are taken to the Chinese island of Hainan, where they are carved into decorative items and sold to tourists.
“There is no hope for many of these reefs to recover in the coming decades or centuries,” Kent Carpenter, a professor at Old Dominion University in Virginia and another coral expert consulted by the tribunal, said Wednesday from the Philippines, where he’s on a research trip. “China is trying to solidify its claims, and they obviously have decided not to worry about the environmental aspects. … The environment there is now just written off.””
and on top of that, there is the bleaching problem… (sad face)
I hate to say this, but 30 remaining dolphins means this species is effectively extinct.
Yup! Pretty much!
And despite Caelan’s inability to recognize sarcasm when he sees it, genetic engineering, CRISPR and gene drives, are highly unlikely to save this or any other species already this far gone.
Which is not to say that we shouldn’t use the best available science and technology to keep trying. Side note: I have personal friends who are working on coral restoration in that region and they are looking at ways to use genetic engineering to produce more hardy corals. They also have a large underwater coral farm and are working on planting corals in dredged out areas.
I guess Caelan would consider my friends to be integral participants in the world of the so-called/crony-capitalist-plutarchy-derived science and technology. Yet he hypocritically posts his holier than thou drivel using access to that same system and technology here on this site every day.
It is not without a sense of bitter irony, lost on you apparently, that you would write that brilliant piece of prose on a collapse blog.
You’re making the drive-by AGW-denialistic commentary look increasingly straight-up by comparison.
Haha
“Baghdad Bob” Spicer
http://indianmavericks.blogspot.ca/2017/04/the-daily-donald-4272017.html?m=1
April 26
CO2 412.63 ppm
https://www.esrl.noaa.gov/gmd/ccgg/trends/monthly.html
Daily CO2
April 26, 2017: 412.63 ppm
April 26, 2016: 407.41 ppm
https://www.co2.earth
Disclaimer: The atmosphere is composed of about 78% Nitrogen and 21% Oxygen by volume. No other gas constitutes more than 1%. CO2 is, in fact, a trace gas representing approximately 0.04% of the volume of dry air in the atmosphere. The attached figure below illustrates a proper context for understanding the true significance of measurements concerning atmospheric CO2 concentration.
Moreover, for additional explanation, you may wish to reference the Wikipedia “Atmosphere of Earth” entry. https://en.wikipedia.org/wiki/Atmosphere_of_Earth
Got tired of being shot down? Trying a new load of propaganda?
NAOM
For anyone interested in those pac-man charts, they are incorrect and do not show the correct proportions at all.
NAOM
Why deal with truths when one can deal with reality.
Reality: Current CO2 content of atmosphere is 3 trillion tons. CO2 produced from human activity totals 2 trillion tons. Change in atmospheric CO2 levels is 51 percent, change in H2O levels is at least 33 percent. Atmospheric methane has more than doubled.
Reality:
At present, roughly 30% of the incoming solar radiation is reflected back to space by the clouds, aerosols, and the surface of Earth. Without naturally occurring greenhouse gases, Earth’s average temperature would be near 0°F (or -18°C) instead of the much warmer 59°F (15°C).
NASA GISS: Science Briefs: Greenhouse Gases: Refining the Role of …
https://www.giss.nasa.gov/research/briefs/ma_01/
Reality: The albedo changes in the Arctic due to melting will double the global warming from GHG’s, which is producing more GHG’s from natural sources.
Reality: The actual atmospheric temperature change from all this will be about one percent for a 3C change.
Pure comedy gold.
Stay in school kids!
Oh, our old Troll is back again and again and again… now he is using visual aids to spice up his presentation.
Don’t worry about it, Fred…his visual aid is illegible and boring, and could be mistaken for an homage to Pac-man. Makes our comments look good.
-Lloyd
Latest forecast: 0.2 percent — April 27, 2017
(we need 2% to keep the ponzi from being exposed)
https://www.frbatlanta.org/cqer/research/gdpnow.aspx
Oil prices are tanking, now below $49 a barrel at a 4-week low
http://www.cnbc.com/2017/04/27/oil-futures-are-down-nearly-2-in-a-brutal-week-for-crude.html
First sighting of a Tesla in my area. Parked at a shopping center. Must be the thought of more EV’s keeping the price down. 🙂
Five new Tesla vehicles that might show up soon.
https://electrek.co/2016/10/23/5-tesla-vehicles-coming-by-2020/
While the Dim’s are not much better, how about this statement?
“I also said that it’s an extremely outrageous statement. But the question is whether it’s true,” replies Chomsky. “I mean, has there ever been an organization in human history that is dedicated, with such commitment, to the destruction of organized human life on earth? Not that I’m aware of. Is the Republican organization—I hesitate to call it a party—committed to that? Overwhelmingly. There isn’t even any question about it.”
-Chomsky
Considering that humans are high end territorial predators, easily angered, highly destructive and intrinsically insane explains the state of the modern world.
And to think we’re God’s children.
We are Nature’s children.
I was born from a mother, not created. My lineage goes back to a bunch of slime in a strange and primitive world. So basically I am the result of millions or billions of successes, the winners one might say in the long trail from primordial slime.
If anyone thinks that we are not natural, just look in a microscope at tissue samples. We are made of cells. Yes organized and differentiated cells but cells none the less. It is the development of the replicating cell that has produced all the versions of life we see or have found evidence of in our diggings in the earth. We are just cells stuck together that learned to work together to survive.
The very words “God’s Children” implies we are demigods. We are just animals with imagination and an improved language capability. Dolphins can probably do that too, but luckily for them do not have arms, hands and an opposable thumb to allow manipulation of the environment.
But man, proud man
Dressed in a little brief authority
Most ignorant of what he is most assured
His glassy essence, like an angry ape
Plays such fantastic tricks before high heaven
As to make the angels weep.
Shakespeare
STUDY REVISES THE DEVELOPMENT, EVOLUTIONARY ORIGIN OF THE VERTEBRATE BRAIN
“The human brain has undergone an evolutionary process that began some 500 million years ago in the marine animals that lived submerged in the sand and which led to its first central nervous system building plan. This system has been progressively modified and is shared by all modern vertebrates.”
https://www.sciencedaily.com/releases/2017/04/170428102054.htm
Yes, we are all related and one big happy family.
Except we know that when the Monolith appeared it modified our brains and made us the wacko creatures we are now. Creatures who are rushing forward to a future they think is unknown, but whose drive is buried deep down in the subconscious. A drive to eventually create Monolith technology. We can then seed other planets with Monoliths across the galaxy. Which will in a few cases cause a repeat of the process in some alien creatures.
Feel used? 🙂
The people of this country are mostly pretty decent people, considering we are after all just naked apes with hypertrophied brains, controlled by more or less hard wired programming suited to our natural environment as hunter gatherers.
If by some great stroke of luck, or strategy and hard work, the REAL big D Democrats manage to break the hold of the faction I refer to as the Democratic Lites, who are altogether too much in the pocket of big business, big banks, big this, that and just about everything else big, THEN things might get better.
The D Lite’s good on personal liberties, civil rights, etc, but they leave a hell of a lot to be desired in terms of really doing what needs to be done , in some key respects. They are miles ahead of the R’s in respect to environmental issues, which is obvious enough even a blind person can see it as bright as the noon sun. They must be given substantial credit for most of what has been done in recent times by way of subsidizing the renewable energy industries, etc.
But so long as they look after themselves, and their preferred friends and neighbors and business associates, who taken all together as a group are rather well off, and therefore insulated from the reality of the day to day lives of most of the citizens of this country……….. The Republicans will either remain in power, outright, or be numerous enough to ally with the D Lite D’s and things will stay about the same as they are now, or maybe get worse.
The elitist Democratic establishment, aka Democrat’s Lite, are now engaging in the same game that the R’s and right wingers played , using the word “liberal” as an insult, an accusation of arrogance, stupidity, or worse.
The D establishment, backed by some of the media, are now showing signs of abusing the word “populist ” the same way.
Language is messy as a general rule, and American English is especially messy, with phrases and words meaning different things to different people. Populism leaves a lot to be desired, in some respects, as it is classically defined in dictionaries and textbooks, but………. calling people who are doing what they can to put people in office who will put the PEOPLE of this country, and the environment first and foremost “populists” with a sniff and a sneer, implying they are ignorant, stupid, uncultured, etc, well, such people are making a mistake.
Conflating people on the political left calling them populists and people on the right also calling them populists is an even bigger mistake.
There are people on the right who are pretending to push policies and values that can be described as populist, but for the most part…….. they aren’t not really. They’re saying one thing, and doing something else.
There aren’t enough Democrats Lite to win elections without the working people of this country voting WITH THEM. That’s why the R’s own the government from the White House down to dog catcher, as a general rule, excepting California, and the North East.
Hopefully elitist Democrats, the sort with money the sort with diplomas from universities, have brains enough that this dirt simple truth will EVENTUALLY penetrate , and they will make the necessary compromises with the working classes, so as to GET BACK TO WINNING elections.
No matter how many times global elites see the rotted fruit of their piggish behavior, they continue to pursue it.
For anybody with the urge to chip away at his ignorance, lol.
http://scpd.stanford.edu/ppc/renewable-energy-courses-GDN?utm_source=google&utm_medium=GSP&utm_term=energytechnologies&utm_campaign=Energy&_vsrefdom=Adwords-Other&gclid=Cj0KEQjw0IvIBRDF0Yzq4qGE4IwBEiQATMQlMT_NOSohFV96Aen6cZxw-EW18NdINfAJ7yVH0fcJhu4aArkc8P8HAQ
Some of these courses are free.
Something tells me we are just about all of us old farts, here in this forum, and if we want to stick around until we’re REALLY old farts, we better be paying attention to our health, and doing some thinking and research on our own, rather than just relying on what the establishment tells us.
Scientific American picked this up from STAT.
https://www.scientificamerican.com/article/records-found-in-dusty-basement-undermine-decades-of-dietary-advice/
It’s a site old guys who want to live a while longer should read often.
There’s also a bit of a lesson in it about respecting people who question the status quo consensus in any field. The consensus is generally correct, but not ALWAYS correct, and a lot of people understand that the establishment consensus explanation for many problems or issues is occasionally incorrect.
So – IF such a person questions the climate science consensus, or some other establishment consensus concerning the environment or public health issues, etc, he MIGHT NOT be ignorant, and he might not be a troll.
The folks who post comments here that question or deny the current climate science consensus ARE trolls, in my opinion, just about every last one of them.
But when we get into a conversation with a coworker or neighbor or the guy sitting next to us on a plane……….. well, that guy may be a doubter, but he may also be willing to listen, if you talk to him respectfully and avoid pushing his hot buttons.
I don’t find this particularly surprising, it’s covered well in Bad Pharma by Ben Goldacre. Statins may have health benefits, but it may have nothing to do with lowering cholesterol. The reason ‘high’ cholesterol levels are set where they are is because the pharmaceutical companies said flat out that if they were set where initial studies indicated then very few drugs would be sold and there’d be no more funding. So the levels were bumped up by one, and then rounded up to a whole number in Europe. Some early results were skewed by one gene in a small section of the population that causes high cholesterol and lowered life expectancy – but not necessarily causal or treatable by statins.
There are some questions about blood pressure treatment as well: risks don’t take off dramatically until the high level is above 15o (from memory) , but people are treated with drugs (probably for evermore) from 135 to 140. The ‘numbers needed to treated’ is then about 100 – i.e. 99% of the drugs aren’t making a difference for strokes and heart attacks. A bit of exercise and slimming down if seriously overweight does much better (this also has the same success rate as drugs for many depression and anxiety issues).
I guess that should say the risk limits were lowered rather than raised.
George, just an aside, but can one get arthritis from getting somewhat overweight and/or from lack of exercise/calorie-reduction?
I think arthritis just means inflammation in a joint. There are multiple possible causes, e.g. gout – that would definitely be related to lifestyle, rheumatoid is autoimmune I think. I have or had three different joint problems myself all different. I lost a bit of weight and it helped to take some of the strain off, one of the others to do with a ligament definitely would come back if I didn’t stretch and resistance train that hip.
Perfect, thanks and best with your joint problems.
But when we get into a conversation with a coworker or neighbor or the guy sitting next to us on a plane……….. well, that guy may be a doubter, but he may also be willing to listen, if you talk to him respectfully and avoid pushing his hot buttons.
Agreed! It’s just basic common sense to treat strangers with respect and to give them the benefit of the doubt. It absolutely does not apply to the batch of trolls that regularly visit here.
Feed stock for some serious conversation!
http://news.nationalgeographic.com/2017/04/mastodons-americas-peopling-migrations-archaeology-science/?sf73771400=1#close
Very weak evidence. This doesn’t change anything unless much more robust information comes along. There are literally tens of thousands of data points leading towards the peopling of the Americans first at 14,000 yrs ago. Show me the tools, the fire, the human bones, some DNA, something more concrete from this site, or from anywhere in N. or S. America for that matter from before 14,000 yrs ago.
Nat geographic has been surprisingly sensational with their editorials and opinion pieces, sadly. Kind of like the history channel.
If you like pondering human history, I recommend 2 thought provoking books-
‘Guns Germs and Steel’ by Jared Diamond
‘Sapiens’ by Yuval Harari
‘Why the West Rules…… For Now’ by Ian Morris is also quite good I think.
I agree, the evidence is weak, and National Geo is maybe playing the sensational card too often, but maybe that’s ok, if it builds readership, donations, and general interest in the environment, etc.
But sometimes weak evidence leads to new discoveries, and some capable scientists appear to have reached the conclusion that the dating is accurate, and that SOMEBODY, rather than natural processes, worked these bones and stone fragments. There might yet be some new species related to us that have not yet been discovered, or if discovered, not yet accepted due to a lack of sufficient evidence.
I have read most of Diamond’s work, and Guns Germs and Steel is a book that I consider ESSENTIAL reading if one wishes to think of himself as well informed ( lay level ) in respect to the history of civilization with a focus on technology, trade, and power politics.
If I could spend an evening over drinks around a campfire with three or four of the regulars here, plus any well known writer, Diamond would be on my top ten list, living or dead.
Ethics of Technology
See also above.
Very weak arguments as the Wikipedia editors also acknowledge.
This article has multiple issues. Please help improve it or discuss these issues on the talk page. (Learn how and when to remove these template messages)
This article needs attention from an expert in Philosophy. (May 2009)
This article includes a list of references, but its sources remain unclear because it has insufficient inline citations. (August 2009)
Toilet paper, you can use it to wipe your ass or you can take a full roll and shove it down someone’s throat to murder them. Either way it is a product of the world of the so-called/crony-capitalist-plutarchy-derived science and technology… Though it does keep plumbers working when it clogs the toilets so they can then buy more toilet paper themselves. Or just for shits and giggles you could imagine a utopian world where there are 7.5 billion composting toilets and no internet.
“Or just for shits and giggles you could imagine a utopian world where there are 7.5 billion composting toilets and no internet.”
7.5 billion toilets and 1 billion people = no waiting. Paradise achieved.
It wasn’t that long ago that people were pooping into a hole in the ground or into a bucket. Before that people pooped all over the place, as it should be.
But we are highly outnumbered by our things. Just think of all the things in just a plumbing system. Lengths of copper pipe, valves, t-fittings, gaskets, washers just to name a few. Next think about a home electric system from load center with breakers, to cable, wire nuts, junction boxes, connectors, outlets, outlet covers, switches, and on and on.
The number of things to run a mechanized technological society is extremely vast in number. Then there are the mines, smelters, foundries, manufacturing sites, the transport, the machine shops and on and on. Forget about 7.5 billion people, think about the trillions of things needed just to keep this system going. All of it needs to be replaced, substituted, and dumped/recycled eventually.
Every thing breaks, wears out, becomes non-economical, outdated, corroded.
Screw science and technology any old ape can swing on a vine…
http://www.chegg.com/homework-help/questions-and-answers/jane-whose-mass-525-kg-needs-swing-across-river-width-d-filled-person-eating-crocodiles-sa-q7861755
Jane, whose mass is 52.5 kg needs to swing across a river (having width D) filled with person-eating crocodiles to save Tarzan from danger. She must swing into a wind exerting constant horizontal force F on a vine having length L and initially making an angle ø with the vertical (see figure below).
Take D = 50.1 m, F = 109 N, and ø = 45.0 deg.
A) With what minimum speed must Jane begin her swing to make it to the other side?
B) Once the rescue is complete, Tarzan and Jane must swing back together across the river. With what minimum speed must they begin their swing? Assume that Tarzan has a mass of 74.4 kg.
.
Jane is smarter than most euro types having watched Tarzan swing through the trees. She climbs up the tree near her for a higher start and has plenty of velocity to reach the other side (gravitational boost). Bad part is that Tarzan falls off the bank in an attempt to slow her down and must kill the crocodiles. So there is no problem crossing back. Tarzan then presents her with several crocodile hand bags, boots and other items. Win -win for the man-ape.
BTW, this technique was invented by flying squirrels. Later they grew membranes to glide with when there was a vine shortage.
In attempting to make the necessary calculations, both Tarzan and Jane lose their concentration and fall into the water, to be eaten by the crocs, but not before the ‘fruit of knowledge’, ironically, had already had a bite taken out of it.
The general definition of encyclopedia is as a reference/compendium/summary. This means, the link goes to a ‘meatball on a toothpick’. So what that it’s a meatball on a toothpick without any sauce or spices. IOW, red herring, along with your toilet paper nonsense.
Rocks are good for busting nuts, and good for busting heads. I have busted many a black walnut with a rock, especially selected many many years ago for the job, since it’s just the right size and shape and just heavy enough. It has it’s own place on a shelf on the porch. I’ve never tried it on the HEAD of another naked ape, but I HAVE thrown it at a raccoon that got into the habit of eating the cat’s food, and hit it, and it apparently took the hint, lol.
See here.
Let’s look at which countries Americans think are the greatest enemies at the present time. Which of these countries do you have on your list of enemies?
Meester Frisky, wha chu takin bout man? Numero uno bad hombre country ees Mexico!
They buildin BEEEG WALL to keep stupid greengoes out! Don cha know anytheeng?
.
EPA website removes climate science site from public view after two decades,
Adds a bit more credence to my ‘Stupid Greengoes’ comment.
The new slogan:
Make America a Dump and Dumber Again.
Hi all,
New Open Thread at link below.
http://peakoilbarrel.com/open-thread-non-petroleum-april-29-2017/