259 Responses to Open Thread Non-Petroleum, April 19, 2017

  1. islandboy says:

    The IEA Photovoltaic Power Systems Programme web site just published their 2016 Snapshot of Global PV Markets summarizing the activity in the global PV markets for 2016. The graphic below best sums up the year, a massive push by China to get lots of PV installed!

    At 78.1 GW of cummulative capacity installed, China falls just 7.5 GW short of having twice as much PV as the country with the second largest cummulative capacity, Japan at 42.8 GW. There are a couple of other interesting take aways, looking at data from last year’s international survey report on Trends in Photovoltaic (PV) Applications up to 2015 provided to you by the IEA PVPS. The capacity installed by China in 2016 was 5 GW short of the amount installed worldwide in 2010, that is, in 2016 China installed 87% of the capacity that was added worldwide in 2010. The amount of PV capacity installed in the US in 2016, was slightly less than the capacity installed worldwide in 2008 and would have qualified for the largest amount ever added by a single country as recently as 2014 (in 2015 China added 15.5 GW).

    The growth in the PV market is beginning to look like it is enetering bubble territory. If it continues at this rate, PV will start to displace fairly new FF capacity in a serious way before long (less than five years is my WAG). Maybe that’s why the FF industries are so “up in arms” about the “massive” subsidies being given to renewables. 😉 It also seems that there is a somewhat unhealthy dominance of China in the PV manufacturing arena. Is there any other critical industry where so much manufacturing capacity resides in just one nation? I guess computers, mobile phones, TVs (screens) and semiconductor based industries in general might qualify but, I am somewhat uncomfortable with so much manufacturing capacity being concentrated in one country,

    • OFM says:

      Any body with an abc level knowledge of history should be at least concerned to alarmed when any country, other than his own, or at least one very closely allied with his own, dominates an industry critical to the future to such an extent.

      It’s not just the actual manufacturing of the end product. There are hundreds and thousands of specialty trades and professions and businesses that provide in puts and services to large high tech industries, and the countries WITHOUT the manufacturing capacity are all too apt to find themselves falling farther and farther behind, eventually to the point they have no real hope of ever catching up again.

      When a locality, or a country loses out big time in any given industry, it means the collateral support for other industries shrinks both in terms of capacity and capabilities.
      In my neighborhood, we used to have very well stocked industrial supply houses, and very high class machine shops capable of turning out one of a kind equipment, made to order.

      These supply houses are mostly gone, and the machine shops are mostly gone, and this means we are less well situated to attract new industries that need this sort of support. They’re gone because the furniture and textile industries were mostly shipped overseas.

      There are such things as tipping points in economics, just as there are in climate.

      • GoneFishing says:

        Clothes are junk products now as are shoes.
        US manufacturing is doing just fine, it is 30 percent above it’s 2009 low and rising lately. It’s real output is almost double 1988 output. The US is the second largest manufacturer in the world.
        You are correct about textile mills. Employment is around 120,000 in the US currently and was 500,000 back in 1990. The paper industry employment went from 650,000 to 350,000 in that time period. Both industries are running fairly flat now.
        Similarly apparel manufacturing has taking a 80% loss in employment since 1990, from about 1 million employees.
        Computers and electronic manufacturing has fallen by 50% in the US since 1990.
        It’s hard pressed to find a manufacturing sector that has not lost employment.

        Yet manufacturing output is up 260% in the last four decades.
        Gross output of U.S. manufacturing industries — counting products produced for final use as well as those used as intermediate inputs — totaled $6.2 trillion in 2015, about 36% of U.S. gross domestic product, nearly double the output of any of the other big sectors: professional and business services, government and real estate.

        http://www.marketwatch.com/story/us-manufacturing-dead-output-has-doubled-in-three-decades-2016-03-28

        • OFM says:

          Manufacturing as a whole is doing ok, true. But there’s no reason, really, to believe that the human naked ape has or will change it’s stripes, to make a mixed metaphor, and that the world will remain peaceable from here on out. It’s never really been at piece, except at odd times, since the nation state evolved into something big enough to make war over long distances.

          I personally don’t like the idea of having to go hat in hand asking our potential first or second worst enemy for supplies of materials critical to our economy when it looks as if bullets and rockets may soon be flying.

          Now clothing we could buy just about anywhere, no problem, for the next fifty years, there will always be some poor country willing to make clothing as one of the first steps up the industrialization ladder, and enough people doing it in such countries we are not going to be at risk of becoming involuntary nudists, lol.

          But the folks who argue such issues on the basis of economics textbooks and comparative advantage,etc, are trapped inside an intellectual box that sits inside a larger actual reality.

          The exportation of countless textile and furniture industry jobs has had a hell of a lot to do with political outcomes here in the USA, one such being the R party take over of states where these industries were concentrated.

          Of course it WAS the R party that played the larger role by far in the workers in these industries taking this hit, but HRC was politically stupid enough to run as a globalist last time around, this being one of the many straws that could be THE one that broke her camel’s back, given how close it was in the last three big rust belt states Trump won.

          And while we as a whole can survive just fine without furniture and textiles, the folks who support globalization NEVER NEVER NEVER seriously acknowledge the indisputable truth of the actual price we paid in allowing these industries to be exported. More trouble of every sort has been the consequence in former textile and furniture towns and rural areas, more social workers, more cops, more crime, more broken families, more people on welfare, greater income inequality, etc.

          And nobody has ever paid more than lip service, really, to actually doing anything for the people who got screwed. You can’t change a middle aged man or woman who can barely read a newspaper or balance a check book into a high tech worker for an industry that does not exist locally, and has zero desire to locate locally. That sort of talk is complete and total BULLSHIT and it takes an IDIOT to believe it.

          But you CAN change such a person into a voter who will vote his or her rage at the first opportunity.

          Now would all the people who are doing well or great be better off wearing clothing imported from third world workshops, or paying a few bucks more for domestically manufactured, considering the political price they have paid?

          A straw here, and a straw there, and pretty soon you’re talking about a real load of hay, enough to bring about political tipping points.

          • Nick G says:

            he folks who support globalization NEVER NEVER NEVER seriously acknowledge the indisputable truth of the actual price we paid in allowing these industries to be exported. More trouble of every sort has been the consequence in former textile and furniture towns and rural areas, more social workers, more cops, more crime, more broken families, more people on welfare, greater income inequality, etc.

            Except…it’s not true. It’s just not true that this unemployment was caused primarily by offshoring. It was mostly caused by automation, right??

            Was it a mistake for HRC to not lie like Trump about lost manufacturing employment (not to mention offshoring), and pretend that it could and would be reversed? Perhaps. Perhaps it was not politically smart to be honest about the future of these kinds of jobs (maybe she would not have taken that risk if the polls had been accurate).

            But, leaving aside the “inside baseball” of political strategies…we should acknowledge the truth. Offshoring was not the primary cause of the problems of people with educations at high school or below – it was automation.

            Right?

            • HuntingtonBeach says:

              Hi Nick,

              It was my impression, that in the late 90’s and early 21st century offshoring was mostly the problem. But for the last 10 years it’s been automation. On top of that, add into the mix. The loss of influence of unions, increase cost of higher education and influx of hard working immigrants. The unskilled and poorly educated don’t stand much of a chance today of any quality of standard of living. Then there is also the do nothing congress for the last 8 years and the public that demonizes government.

              Personally, I’m a supporter of Keynesian economics and felt the 2009 stimulus was to small and Obama should have fought harder at the time for it to be bigger. The sooner the economy got back on it’s feet. The better everyone would have been(the Republicans knew that). I also feel the country can’t agree on a direction. Like the space program or interstate highway system. Just cutting taxes and more military spending is not a fix. Transforming to a low CO2 energy platform economy would be a great direction, but the fossil fuel industry has been fighting that all the way. Which in the long run, will leave America farther behind the rest of the world instead of leading it.

              Good to see you back

              • Nick G says:

                Thanks!

                I agree with your thoughts, generally.

                I’m often surprised how much most people don’t understand labor productivity.. People think “robots”, or “automation”, and think it’s new, but over the history of the US (and the modern world), increasing labor productivity has been the primary driver of rising prosperity (and job loss!) It’s been an accumulation of knowledge about how to get work done faster and better. As that knowledge has accumulated, change has accelerated. People think specific inputs, like energy, or trade, or metals, etc., are the secret sauce – if any one of them had been missing, it would have slowed things down, but not forever.

                That means job loss. Agriculture has gone from 50% of jobs to 2% in the last century. That’s dramatically reduced the cost of basic food, but those workers had to go somewhere else. The US is still a net exporter of food, but…ag employment has disappeared. Now, manufacturing is going through the exact same thing.

                So, prosperity means disruption: people changing jobs, industries disappearing and being replaced by other industries. And disruption is often very, very painful. The Okies were displaced by tractors; the UAW workers were displaced by inexorable improvements in assembly line productivity. They went through hard times – some recovered and did better than before, some never recovered. Republicans push policies that hurt such people (ACA repeal, etc), Democrats do somewhat better.

                Offshoring is real. US manufacturing output more than doubled from 1979 to 2000, but manufacturing employment didn’t grow – it stayed flat due to growing labor productivity. Then, around 2000 China joined the WTO, and after that US manufacturing stopped growing. That meant growing labor productivity caused employment to drop quickly.

                The bottom line: most of the crash in manufacturing employment was caused by “automation”. Offshoring has played a part, but when politicians blame unemployment on imports, they’re scapegoating.

                Now, why does it feel like it’s due primarily to imports? One reason I can think of: as automation shrinks employment, at some point fewer factories are needed, and the work will be consolidated into fewer locations. Those closings tend to be blamed on offshoring, especially if the remaining factory is in a lower wage location, e.g., a furniture factory in Grand Rapids MI is consolidated into a factory in N. Carolina.

                • GoneFishing says:

                  There is another factor also. Jobs are being eliminated without any substitute. Three jobs may become one with one person covering three locations. Not to say the job will be done as well, but the cost is less for the companies. I have seen whole departments eliminated and the jobs spread to the other employees. Tacking on tasks and then expecting improved productivity is a common ploy in corporate America.
                  It’s a hidden way to reduce costs. Management positions are very susceptible to this type of head cutting.

                  • HuntingtonBeach says:

                    Correct, it’s more than just manufacturing. It’s managing and tracking employees. No more utility meter readers, scanning your own purchases at the store, assisting outside sales and service. Plus soon the elimination of drivers.

                  • Caelan MacIntyre says:

                    The elimination of jobs through technology has been discussed and taken place over decades, likely centuries. It’s nothing new. Meanwhile we have essays, such as from the likes of Graeber, talking about the ‘phenomenon of bullshit¹ jobs’. Bullshit² jobs aren’t really anything new, either. Most jobs are probably bullshit³, in a bullshit⁴ so-called economy.

                    It is suspected that, despite the bullshit⁵, this time, it is less so much about technology, as about the underlying issue of general decline– nothing new there either of course…

                    In a pre-peak oil era with a ‘hot-running bullshit⁶ economy’, bullshit⁷ jobs could be relatively-easily manufactured. Not so much this time around.

            • OFM says:

              “Except…it’s not true. It’s just not true that this unemployment was caused primarily by offshoring. It was mostly caused by automation, right?”

              It’s true that a substantial number of manufacturing jobs have been lost to automation, no doubt at all.

              But it’s also true that millions were lost to being exported. The fact that a lot of lost jobs were lost to being automated does NOT mean the D’s didn’t pay the price by losing the WH because of the ones that were exported.

              The fact that jobs were lost to automation does NOT CHANGE the political calculus, or the lives of people who lost their jobs due to their jobs being exported.

              NICK, notice that I say right up front that the R’s are actually the ones mostly responsible for exporting our lost industries.

              You always or nearly always respond as a partisan, minimizing or denying any facts that don’t suit the D party agenda, or that illuminate why the D’s are in the political dog house.

              It’s also true that the people in communities that lost these jobs have suffered immensely, and that hardly anything has ever been done by either party to make up for it.

              It would not have been necessary for Clinton to tell any additional lies to the many she has told, taking note of the fact that when it comes to lying, Trump makes her look like a six year old Girl Scout. All politicians tell lies, some are better at it, and some tell a lot less than others. Clinton doesn’t tell ten percent as many as Trump. Unfortunately some of the ones she told rang untrue with ENOUGH voters who abandoned the D’s for the R’s this last time around.

              Keep in mind that it’s possible to tell lies by OMISSION as well as commission. Spend all your time with banksters, and politically potent but relatively tiny voting blocks, and ignore OTHER, MUCH LARGER voting blocks, and the larger block DOES notice it has been snubbed, and a few remarks here and there will NOT be enough to convince the snubbed voter he or she still matters.

              Quite a lot of people voted for Trump not because they wanted Trump, but to send an unmistakable message to the D party, and to the R party establishment as well, when you get right down to it.

              All that she would have had to do is have had sense enough to hang around less with banksters, and Holly Wood types, and got out among the people who are the real core, or used to be, the real core of the Democratic Party, and campaigned AMONG THEM like she meant it, without EMPHASIZING the issues that turned off voters scared for their jobs.

              She could have hung with banksters QUIETLY. She and her dogs could have talked RESPECTFULLY to and about Sanders voters, rather than playing every possible dirty trick to manipulate the primaries.

              Perceptions have as much or more to do with winning elections as actual facts.

              She lacked political savvy enough, enough FEEL for the mood of the country, to understand what was going on.

              I believe Bill C tried to tell her, but she was determined to listen to her yes guys and girls, rather than the guy who is arguably the smoothest and sharpest politician of recent vintage, going back at least as far as Ronnie Raygun, who also had the common touch in spades.

              • HuntingtonBeach says:

                Well this is plain Bullshit !

                First off, you should have posted this comment under the screen name Trumpster.

                Second, these types of posts are suppose to be for me. If you going to start writing around on me. Then we’re over and I’m filing for divorce. Then, this is truly going to get ugly and I don’t think your ready for that. So, just put your very little hands back in your pockets and go back to business as usual.

                So tell your little boyfriend Nick that it’s over and don’t let it happen again.

              • Nick G says:

                The fact that a lot of lost jobs were lost to being automated does NOT mean the D’s didn’t pay the price by losing the WH because of the ones that were exported.

                Yes, it does. Trump claimed that offshoring was THE problem. That’s not true. It’s not the main problem. Most of those jobs would have been lost anyway.

                So, if people voted for Trump because of “offshoring”…they were voting based on a lie.

                The fact that jobs were lost to automation does NOT CHANGE the political calculus

                Yes, absolutely it does. It makes a big difference that 80% of the job losses were due to “automation”, and that they are NOT coming back.

                Trump claimed he could bring them back. It’s NOT true.

                notice that I say right up front that the R’s are actually the ones mostly responsible for exporting our lost industries.;

                That’s true, but not relevant. The main thing is that…exporting industries was not the main thing.

                You always or nearly always respond as a partisan

                No. You’re not hearing what I’m saying. I don’t care about big D tactics. Or big R tactics. I’m talking about the big picture, the fundamentals. Not (mostly) this election.

      • Nathanael says:

        This is the Chinese century. We passed the tipping point a while back now. Reagan/Bush I decided to make *sure* that we lost the economic lead to China. Too late to change that now.

        If I were younger, healthier, and better at languages and I wanted to have a future successful career I’d move to China.

        • Suyog says:

          They used to say the same thing about Japan 25 years ago.

          • Caelan MacIntyre says:

            ‘This is the Chinese century’ ‘talking-point meme’ is ‘so last century’. ‘u^

          • Nathanael says:

            You only see the tipping point in retrospect. Now that China controls all the major strategic industries in the world… *and* has the most statesmanlike government of any major power… y’know… it’s become clear what happened.

            Will it last a century? Maybe not. But the point is, the US is definitively #2 now.

        • HuntingtonBeach says:

          Don’t forget to write

      • alimbiquated says:

        The panels aren’t such a big deal. The polysilicon is more important, and production is more spread out.

        That said, I agree that America needs to do something about its declining industrial competitiveness. I think the solution is to nurture communities where people who know how to build a run factories live.

    • Dennis Coyne says:

      Hi Islandboy,

      Is there data on PV output? The output numbers are what matters as capacity doesn’t always result in the same output increase as location determines utililization rates, so output or consumption is the key data.

      • Hickory says:

        To the point Dennis is making, the capacity factor is a key aspect of a power plants output. For example, a nuclear plant typically has a capacity factor of 80-90%, because its needs to be taken offline for periodic maintenance and refueling, so it can’t be running full speed 100% of the time. If it could, it would have a CF of 100%.
        Typical wind energy CF in windy spots is 25-40%.
        The PV data presented here is the nameplate capacity (max output if in Sahara direct sun 24/7/365). PV annual kwh production is a much more important number.

        Nonetheless, great trend.
        btw- I sure wouldn’t want to see trump tariffs imposed on Chinese PV, just so we could have more expensive panels made in USA.

        Capacity Factor- https://en.wikipedia.org/wiki/Capacity_factor

        • Gerry says:

          CANDU reactors can be refueled while in full operation, yet they are not being operated at higher capacity factors than conventional PWRs are.
          There’s always a huge discrepancy between nuclear promises and nuclear reality.

          • OFM says:

            The nukes in my neck of the woods have performed admirably ever since they were put into service, and although they are now nearing the end of their life cycle, they are still running in the high eighties, and low nineties, in terms of capacity, and even setting some performance records in recent years.

        • Phil S says:

          PV nameplate capacity has nothing to do with the Sahara. It is the peak power the PV module produces under standard test conditions. These standard conditions include allowing for an air mass co-efficient of 1.5. From wikipedia,
          “AM1.5”, 1.5 atmosphere thickness, corresponds to a solar zenith angle of z=48.2°. While the summertime AM number for mid-latitudes during the middle parts of the day is less than 1.5, higher figures apply in the morning and evening and at other times of the year. Therefore, AM1.5 is useful to represent the overall yearly average for mid-latitudes. The specific value of 1.5 has been selected in the 1970s for standardization purposes, based on an analysis of solar irradiance data in the conterminous United States.[9] Since then, the solar industry has been using AM1.5 for all standardized testing or rating of terrestrial solar cells or modules, including those used in concentrating systems.”
          My bold. Solar panels can achieve above their nameplate peak power at lower latitudes.

  2. OFM says:

    This link is longer than most posted here, but it’s chock full of food for thought about climate issues.

    https://phys.org/news/2017-04-streaming-antarctica-survey-liquid-widespread.html

    This one is was an eye opener for me. I had no idea there was so much melting going down below.

  3. Survivalist says:

    Tainter. Collapse. An oldie but a goodie.

    https://youtu.be/RSXKjH_WjWo

    • George Kaplan says:

      Do you have a call for the day of maximum volume, it looks close?

      Keeling curve CO2 was over 410 for April 18th, I think that is the first time ever.

      April 18, 2017: 410.28 ppm
      April 18, 2016: 407.80 ppm

      But the rate of increase is less than 3 ppm now, so despite no La Nina, maybe the oceans have started to pick up a bit more (or expel less).

      • Survivalist says:

        That is a record high daily average for Mauna Loa. They’ve had hourly averages higher but not daily’s.

        This is the closet I can find to running data on volume
        http://polarportal.dk/fileadmin/polarportal/sea/SICE_curve_extent_LA_EN_20170418.png

        From here
        http://polarportal.dk/en/havisen-i-arktis/nbsp/sea-ice-extent/

        And here
        http://polarportal.dk/en/havisen-i-arktis/

        I’d guess that volume is now in seasonal decline.

      • Dennis Coyne says:

        Hi George,

        From

        https://www.esrl.noaa.gov/gmd/ccgg/trends/global.html

        I found under further reading

        http://www.nature.com/nature/journal/v488/n7409/full/nature11299.html

        I only have access to the abstract not the whole paper, but from the abstract we have

        Our mass balance analysis shows that net global carbon uptake has increased significantly by about 0.05 billion tonnes of carbon per year and that global carbon uptake doubled, from 2.4 ± 0.8 to 5.0 ± 0.9 billion tonnes per year, between 1960 and 2010.

        Some might argue that recently there has been an increase in the rate of rise of global CO2, but this might be due to the recent strong El Nino. Using data from link below

        ftp://aftp.cmdl.noaa.gov/products/trends/co2/co2_mm_gl.txt

        found at https://www.esrl.noaa.gov/gmd/ccgg/trends/global.html

        I created the chart below on the trend data, percentage annual increase in global atmospheric CO2 on left axis and the natural log of atmospheric CO2 divided by 278 ppm (pre-industrial Holocene average atmospheric CO2 level) on the right axis.

      • GoneFishing says:

        It’s spring in the northern hemisphere.

        • George Kaplan says:

          Do y-o-y changes depend on the season very much?

          • GoneFishing says:

            There is natural variability and the seasonal variability is slightly larger than the rate of increase.
            The latest decadal rise is 2.4 ppm per year.
            If a near 3 ppm rise is actually occurring it take a few years to actually be sure due to variations stated above.
            Don’t be in such a hurry, doubling of CO2 will occur this century. Methane increases will make it nearly as dominant as CO2. Albedo changes are increasing heating and should soon be the dominant factor in global warming.
            The fact that we can see major changes in just a few decades means the changes are happening over 100 times faster than normal increases in GHG and albedo.

            • Survivalist says:

              I think the decreasing albedo is just gonna hammer us. Once the Arctic Ocean opens right up it’s gonna be some wild weather in the NH. Farmers should have fun with that.

              http://e360.yale.edu/features/as_arctic_ocean_ice_disappears_global_climate_impacts_intensify_wadhams

              • GoneFishing says:

                Article says a 50% gain in heating from loss of Arctic ice and snow. Other scientists have been saying the Arctic changes will double the global heating.

                • L Racine says:

                  Yeah and watch what happens to the permafrost on the Arctic landmasses and the Greenland Ice Sheet… we ain’t seen nothin’ yet!!!!

            • Nicholas Schroeder says:

              The core principle you climate change professionals seem unable/unwilling to comprehend is that our global climate is controlled by the clouds in the sky; greenhouse gases such as CO2 and CH4 are trace gases present in the atmosphere only in relative minute amounts. This means the fact of the matter is, they have surprisingly little to do with a destabilizing climate. Therefore, all this concern about their concentrations here, there, and everywhere is misguided angst, at best.

              Let me explain the current science to you, demonstrated as in Arnold, 2006, among others. Once again, clouds are the driving principle behind global climate processes. Present understanding shows they are formed through upper atmosphere reactions influenced by CR (cosmic rays).

              Furthermore to the point, the sun is also a major driver of earth’s climate; in the form of sunspots in particular. Sunspots generate a solar wind which disperses CR away from earth. Because, as previously discussed, CR influences cloud generation, it naturally follows that a decrease (increase) in the number of sunspots generated by the sun results in proportional increase (decrease) in the amount of observed clouds within the boundary layer on earth.

              Hopefully you are still with me in understanding this complex science. If so, building upon the preceding discussion, more clouds within the boundary layer means a colder earth as diurnal surface temperatures are suppressed. Conversely, the opposite is also true; a lower amount of clouds means warmer surface temperatures. This is all due to the efficiency with which clouds block out the sun’s heat.

              Now, to take this to a natural conclusion, low sunspot activity, such as we have seen within the present solar cycle, has profound consequences for global climate. The mechanism is thus: few sunspots means a calmer solar wind and increased CR, in turn causing more clouds here on earth.

              Quite often in modern science Occam’s Razor applies; the simplest initial explanation is often the correct one. Much of modern climate science is designed to be a money-pushing affair, because the basic processes are already well enough understood.

              • Hickory says:

                Thanks Nicholas,
                I feel so much better now. No need to worry about the hotter and hotter climate. Good.
                How about soil erosion. We can just use sawdust to build up some more soil, right? Right!
                Some people worry about running out of money. No need, just print some more. At home. Good.
                Incidentally, whats your view on colonoscopies?

              • Bob Nickson says:

                No wonder it’s so goddamn hot on the moon.

                Not enough clouds.

              • George Kaplan says:

                I think your comments would be better directed at the authors and reviewers of the papers you disagree with. I’m sure they’ll treat your contributions with the respect they deserve, especially given your evident qualities of politeness, humility and openness to others viewpoints.

              • wehappyfew says:

                Which correlation seems more likely to explain the evolution of temperature?

              • islandboy says:

                Thanks for dropping in and setting us straight! Am I to take it then that that current increasing temperatures and all the melting going on are just a short term, temporary phenomenon? If so, does this mean that I should maybe stock up on blankets and sweaters for when the world returns to the long term cooling trend? Is it also an indication that the world is due for another ice age?

                By the way, what’s your take on my post up top? What with China installing almost half of the amount of PV added globally last year and all. Do you think it has been a good idea for governments all over the developed world to let the “free market” decide what happens, when the Chinese government is obviously not playing by the same set of rules?

              • wharf rat says:

                “Sunspots generate a solar wind which disperses CR away from earth. ”

                Well, there ya go. If the solar wind decreases, so does the solar wind chill, which prolly makes the planet feel warmer. You should write it up and submit it to PNAS.

              • GoneFishing says:

                NS said “Once again, clouds are the driving principle behind global climate processes. Present understanding shows they are formed through upper atmosphere reactions influenced by CR (cosmic rays). ”
                Clouds form in the lower atmosphere, not the upper atmosphere.
                Hey NS, ever heard of condensation? The way clouds actually form is warm humid air rises from the heated ground region and cools as the altitude increases and pressure decreases. At some point the humidity goes above 100 percent and condensation occurs. Voila, clouds!
                Easily observed and experienced. No sunspots or cosmic rays involved. Happens every day.
                Other point is you neglect longwave infrared energy in your “assessment”. You also neglect albedo changes.

            • George Kaplan says:

              At the moment we are following RCP8.5 almost exactly. 2.4 ppm decadal average is slightly higher than the predicted increase for 2006 to 2016. RCP8.5 predicts doubling of CO2 by 2054, and of CO2e by 2045. Admittedly it seems unlikely this would happen as it would require a rate rise to 7 ppm per year, but who knows the way feedbacks are kicking in. Even at 2.4 ppm per year CO2 would hit 560 by 2080, CO2e probably 10 years earlier; RCP4.5 and RCP6 both indicate mid 2060’s for CO2e .

              If I understand the recent papers correctly, and I probably don’t, then a doubling would give an equilibrium climate sensitivity of 4 to 4.5K, but an earth system sensitivity, i.e. including longer term albedo effects, full changes in vegetation cover etc. 50% higher at 6 to 6.75K. Some of the warming potential might be masked, if only temporarily, by aerosols and it would take a few hundred years for the full ESS effects to be seen, but overall that seems to me to indicate most of the earth and oceans would be uninhabitable for most life: ‘albedo effects’ is another way of saying 50m plus sea level rise, and that with ‘changes in vegetation cover’ actually means worldwide, multi-decadal famines.

              It might be worse than that – the indications are that the sensitivity increases as the temperature rises (i.e. the interglacial sensitivity has been assessed at 4.35K compared to 3 in the glacial; we are going beyond a typical interglacial so the model results which include corrected cloud feedback and indicate 5 to 5.2K might be closer) and even if all fossil fuel use stopped the feedbacks from land use, permafrost melt, soil changes, maybe even hydrate release, would continue to release carbon. The way things have been accelerating maybe the hundred-year timescale would actually be significantly shorter.

              On the mitigation side I guess if methane is a big component it would be quickly decaying. Also there is the question of wether we really have enough fossil fuels to get the rises indicated, and are unwilling to stop using them. The feedback changes with lower sink efficiencies and natural releases from soils and permafrost seem to reduce the amount needed with every new paper, but I think coal use (and available reserve) still seems key.

              • Dennis Coyne says:

                Hi George,

                Do you think that much fossil fuel will be easy to extract and burn? You are very skeptical of even my medium URR scenario for oil (perhaps even the low scenario is too optimistic in your view). The high scenarios are roughly between RCP 4.5 and RCP6.0 as far as carbon emissions, and a scenario consistent with RCP8.5 over the long term would require a very unrealistic level of fossil fuel extraction, not very consistent with reality. My medium scenarios are roughly consistent with RCP4.5.

                Also note that the high scenarios are most likely consistent with high fossil fuel prices as much of that resource will come from expensive EOR, deep water off shore, LTO, and extra heavy oil all of which are expensive.
                Perhaps the high scenario for natural gas is possible, but coal is likely to be supplanted by natural gas, wind, solar, hydro and nuclear power as the resource depletes and becomes relatively expensive.

                Chart below shows carbon emissions from my “high” scenarios for oil, coal, and natural gas compared with RCP4.5 and RCP8.5.

                • George Kaplan says:

                  I did some rough and ready calculations (may be wrong).

                  By RCP8.5, 6 and 4.5 it looks like CO2 ppm of 500 to 520 is reached when CO2e is at 560. So assume an extra 100 ppm of net emissions. To get that would require burning 2.4 trillion barrels of oil (85 years at current production), 274 billion tonnes of coal (35 years) or 15 quadrillion cubic feet of gas (120 years) – or some combination. As only about half of the CO2 ends up in the atmosphere those numbers would be doubled. Burning all current oil and gas reserves would produce 55 ppm – I think less oil than predicted will be extracted, but possibly more gas. So the question would be whether there is enough from coal, changing sink efficiency and natural releases trapped, reduced carbon to provide another 45 ppm. It looks likely there will be. It seems unlikely to me that we are going to be able to come up with something to take CO2 out of the atmosphere on a big enough scale to make much difference. Although it can be removed OK the big energy and resource expense would be concentrating and sequestering it.

                  All that above assumes we don’t do anything to reduce fossil fuel consumption, which remains to be seen. But also there is a wide margin for scenarios between where we are and the catastrophic doubling, most of which is pretty bad for most of the world’s population.

                  • Dennis Coyne says:

                    Hi George,
                    Using the average carbon model from MAGICC 6 and the average CMIP3 AOGCM, 1180 Gt of total carbon emissions (560 Gt have been emitted already), peak atmospheric CO2 would be 510 ppm in 2080 to 2085 and then atmospheric carbon levels would gradually fall to 455 ppm by 2500.

                    Some of the scary scenarios are based on RCP8.5, which is highly unlikely, that scenario requires about 5000 Gt of carbon emissions and is at 2 times higher than any reasonable scenario. It is much more likely that we will see something like RCP4.5 at most (around 1500 Gt of carbon emissions), and probably somewhere between RCP2.6 and RCP4.5 ( call it RCP3.6 maybe) is probably realistic.

              • Dennis Coyne says:

                Hi George,

                You are correct that through 2015 carbon emissions (including land use change) have followed the RCP8.5 scenario. After 2015 I expect carbon emissions will fall below the RCP8.5 scenario and by 2025 they are likely to peak.

                Carbon emissions from

                http://cdiac.ornl.gov/GCP/

                RCP8.5 from MACICC at

                http://www.magicc.org/

                The climate sensitivity due to fast feedbacks (clouds, water vapor and sea ice and reduced snow cover extent) is about 3 C for a doubling of CO2, the effects of the changes in ice sheets, land cover and permafrost will add to that about 1 to 1.5 C. Note that the thermal inertia of the ocean causes the increase of 3 C to take about 400 years or more (globally) and the other changes possibly another 500 years, in the mean time carbon dioxide will fall somewhat from peak levels. A scenario I did using a Bern carbon model and 1120 Gt of carbon emissions peaks in 2083 at 510 ppm CO2 and then CO2 gradually falls to 458 ppm by 2500 and to 450 ppm by 5000 CE. If Earth system sensitivity is 4 C this implies about 3 C of warming above the pre-industrial Holocene average temperature.

                Note that the temperature change from LGM to pre-industrial Holocene average was about 3.5 C which implies ESS of 5.5 C. Ice sheets were quite large during the LGM about 10 times larger than today in the Northern hemisphere. This might imply a lower ESS at present of about 3.25 C (rather than the 4 C estimate I gave earlier), in that case warming of 2.3 C is implied by my scenario (458 ppm in 2500 CE).

                The science on this is not very clear. We should keep carbon emissions as low as possible in my view due to the uncertainty, we can always burn it later if needed (and if climate sensitivity ends up being lower than most scientists expect).

                • George Kaplan says:

                  We will almost certainly exceed the RCP8.5 CO2 mid year number this year, but CH4 is likely lower, so CO2e is probably going to be about the same. I have no way at all of arguing with what you think the ESS or ECS or the other one (T something I think) is. I was just going on my interpretation of the recent papers, all of which indicate higher numbers than previously. Also I don’t think anyone knows really how much is going to come from the current dispersed sinks like soil and permafrost.

                  • George Kaplan says:

                    Seems I can’t edit this – I found some of the papers in full on-line for free, and a couple at the local library, but others only as abstracts and/or commentary. Some of the stuff is over my head. If you think I’ve interpreted any of them incorrectly let me know which, with a likn if possible.

                  • Dennis Coyne says:

                    Hi George,

                    Note that different papers arrive at different estimates. Most of the models that match well with the data have ECS around 2.7 C.
                    These models account for sea ice snow cover, but not ice sheets permafrost and land cover change in response to warming.
                    Those other feedbacks are less well understood, but push ESS higher by 1 to 2 C above ECS.

                    Post links to papers and I can read them.
                    Those without links give author and date.

                  • George Kaplan says:

                    Dennis – go here https://robertscribbler.com/2017/04/14/no-el-nino-but-march-of-2017-was-the-second-hottest-ever-recorded/#comments

                    look for comment by wili (I think his 3rd or 4th), it’s a copy of a list, with links, from another comment on a different blog:

                    “28 references [not including either von der Heydt et. al. 2016 nor Friedrich et al (2016)] that either directly, or indirectly, indicate that climate sensitivity is most likely significantly higher than the range summarized by AR5”

                    Yes I realise other research presents different numbers, part of why I presented my interpretation is because most of the new research differs on the high side, and fairly significantly with older stuff.

                  • Dennis Coyne says:

                    Hi George

                    You will need to copy and paste. The models from cmip3 withECS above 3 do poorly. In many cases the papers with higher sensitivity are measuring earth system sensitivity. ECS considers more short term changes over hundreds of years rather than thousands. Even the fast feedbacks operate over 400 years due to the thermal inertia of the ocean.

                  • Dennis Coyne says:

                    Hi George,

                    I agree we may remain close to RCP8.5 for 2016, or perhaps exceed it as far as atmospheric CO2 concentration. I doubt we will reach the 2025 level of 432.5 ppm for RCP8.5. For 2016 the average level was 402.87 ppm

                    ftp://aftp.cmdl.noaa.gov/products/trends/co2/co2_annmean_gl.txt

                    That would require a continued rise at 3.20 ppm per year for the next 9 years. I expect the price of fossil fuels will rise between 2017 and 2025 and the rate of increase in emissions will fall, the RCP4.5 scenario through 2030 is probably pretty reasonable, but from 2030 to 2060 carbon emissions are likely to fall much faster than that scenario as high fossil fuel prices lead to rapid transition away from fossil fuel use.

                  • Dennis Coyne says:

                    Hi George,

                    I think you would need to look at the full literature, for every person that pulls selected articles that point to ECS being higher than in AR5, another person can put up references that say the opposite. The IPCC report is a good middle ground. The evidence for this is there are a bunch of people claiming the IPCC estimates are too low and another group claiming they are too high. My guess is that they are probably about right. The nonlinear nature of ECS is well known. Much of the claims of higher sensitivity is a confusion between equilibrium climate sensitivity and earth system sensitivity. Also many papers use RCP8.5 as their starting point, as we will never see an RCP8.5 scenario (which would require no peak in fossil fuel output before 2100), those papers are best ignored in my view. Papers that consider more realistic scenarios like RCP4.5 are worth paying attention to.

                    Too many papers to read through them all.

                  • George Kaplan says:

                    Dennis,

                    The number of reputable, recent papers giving reduced estimates for climate sensitivity has been few to none that I’ve seen, and those sort of papers are easy to spot as they get jumped all over by the Daily Mail and blogs like WUWT (despite disparaging scientists for the rest of the time). There have been a couple of opinion pieces, such as on Judith Curry’s blog, and there have been some others that don’t have quite such an extreme increase (e.g. one recent one gave 2.9K as median, higher for mean, with 1.7 to 7.1K as the range – “Energy budget constraints on climate sensitivity in light of inconstant climate feedbacks” by K. Armour).

                    None of the papers listed make much reliance on the RCP. I think partly why the sensitivity numbers are useful is that the warming depends mostly on the total release not the rate, doubling is doubling. I looked at RCP’s only to get some idea of likely rates. The blogs that spend a lot of time concentrating on rate seem to think history stops at 2100, so as long as we’re OK then, nothing can possibly go wrong in afterwards, so no need for us to worry.

          • Survivalist says:

            I found this interesting.

            https://tamino.wordpress.com/2012/06/01/annual-cycle-of-co2/

            From what I understand the y-o-y changes are impacted most by location.

    • Troy Slavski says:

      Looks like some tie dye. Got an animated version I can appreciate also? 🆒💹👍😎

  4. alimbiquated says:

    Troubled times in Venezuela.

    http://imgur.com/a/uyDQk

    • Caelan MacIntyre says:

      Paradoxically, Venezuela’s a paradise, as is the rest of the planet.

      The ‘troubled times’ are ‘just’ an outward expression of what’s ‘inside’. Initial conditions. Call it ‘the economy’ if you wish, until it isn’t, if it ever was.

      “…Are the shelves bare yet where you are? Hungry? Don’t know how to grow your own food or where or how to find it? Oh you do? But there are other hungry people running around who don’t? But you own an EV? That’s nice. May I sleep in it too?”

      I was passing by a military barracks the other day and thought to myself how the military are paid by the money stolen from the populations to defend the populations (so the propaganda goes), but when the SHTF, those dubious initial conditions can express themselves quite differently, such as when conditions change and the stolen pay gets more difficult to extract.
      Many don’t think of that.

      Same thing with the police. Say, ‘police state’ to yourself and see how it sits with you.

      One day, you’re getting a traffic ticket with a friendly smile, and the next, you’re their donut, or more so, since you may already be paying for theirs…

      Fair warning.

  5. OFM says:

    First big time wind project in North Carolina is now operational.

    http://www.charlotteobserver.com/news/local/article131684094.html

  6. Survivalist says:

    Putin-linked think tank drew up plan to sway 2016 U.S. election – documents

    http://mobile.reuters.com/article/idUSKBN17L2N3?utm_content=bufferb4c03&utm_medium=social&utm_source=twitter.com&utm_campaign=buffer

    Thanks to the Dunning–Kruger Party.

  7. Nicholas Schroeder says:

    Take a moment or three to dive into the contemporary literature on this matter. Scientists regularly publish reports and stories about new research or understandings, and you can utilize a service such as Google Scholar to monitor their work output; no need to rely on these third-party retelling websites like the ones frequently linked here. The problem with those, you remember how that old childhood game of telephone goes? The more a story gets retold, the less close and truthful it is to the original telling. Plus, within multiple retellings of something, people can start to insert their own biases and agendas.

    Anyway, the current understanding about CR (cosmic rays) and clouds is thus: CD drives the formation of CCN (cloud condensation nuclei) which are the building blocks of clouds. The remainder of the process I already explained in my previous reply.

    • Gerry says:

      Because the Israelis are always the Good Guys ™.

      Just like the US military NEVER commits war crimes and the Russians are ALWAYS to blame for anything.

  8. Survivalist says:

    Areas near the Bering Strait already seeing quite a bit of open water.
    https://seaice.uni-bremen.de/sea-ice-concentration/

  9. OFM says:

    http://www.bizjournals.com/charlotte/news/2017/04/20/viewpoint-duke-out-of-step-with-public-on-solar.html

    NC is now rolling in a big way in the solar power category, even as DUKE does everything possible to slow the progress of the wind and solar industries, while advertising buying and investing in renewables in an effort to fool the public.

    Red NC people support renewable energy, and are happy to see wind and solar farms built in their state, providing employment and tax revenues.

    Renewable energy and a clean environment need not be partisan issues. There’s NOTHING that leftish liberalish leaning people can do to change the rhetoric coming out of the R / Koch camp , but there IS something they can do to promote the growth of renewables , and preserve the environment.

    They could quit shooting off their feet by continuously making smart ass condescending remarks that have the effect of driving rightish leaning voters and potential voters into the big R camp.

    You can take it to the bank that they hear every thing you have to say about them, because the media they read pick it up and repeat it.

    • HuntingtonBeach says:

      Hi OldMacDonald aka KGB Trumpster

    • Nick G says:

      Mac,

      I very strongly agree – we should show respect for each other.

      Now…is there any question that Rupert Murdoch controlled media, and other such media, show great disrespect for the people they define as the enemy, and *greatly* exaggerate (or invent from whole cloth) the disrespect shown BY the “enemy”? Think of Bill O’Reilly, and his “patriots” vs “pinheads”, and much, much worse?

      Is there any question that such media is fanning the flames of conflict? Hate, fear and disrespect-mongering?

      • OFM says:

        Hi Nick,
        Of course the Fox types in the media do everything they can to fan the flames, and confuse the issues, to the end of furthering the agendas of the people who own right wing media, or pay for advertisements there.

        All use of the word “you” is rhetorical in this comment.

        That works for THEM, because so many people are already pissed about the cultural portion of the liberal agenda, and are prone to oppose the environmental portion of it as well, out of cultural tribal loyalty. It works because most of the independent and right wing types who are opposed to renewable energy don’t actually know and understand the actual big picture facts involved.

        BUT it doesn’t work well at all from the leftish leaning end of the political spectrum, because the folks on the leftish liberalish wing are pretty much IN THE BAG, they are more or less already committed to environmentally sound values, and there is NO NEED to mislead and manipulate them in order to keep them showing up on election day.

        A simple example is that gays and lesbians don’t need to be fed a stream of vile remarks about low life right wingers to keep them motivated to show up and vote D. They already KNOW, they are ALREADY motivated.

        So -What I am saying is that as a PRACTICAL matter, when the goal is regaining control of the government by the D party, so as to enact and enforce sound environmental laws and policies, one of the WORST things environmental advocates, unfortunately including some of the members of this forum, can do is bad mouth working class and conservative and religious culture and values. This drives potential D voters by the millions into the opposition camp, while bringing potential voters into the environmental camp in relatively small numbers, if indeed it brings in ANY new D voters. Folks who look down on right wingers already strongly motivated to vote D anyway, and they likely to already know enough about environmental issues to know what is in their own enlightened self interest.

        The typical right winger working class type potential voter is , relative to the typical D voter, seriously ill informed when it comes to the BIG PICTURE in respect to wind and solar power, electric cars, the need for strong environmental protections, etc.

        IF you want his vote, you have to first talk to and about him respectfully, so that he is willing to at least listen to what you have to say. Once you have his attention, then the best path forward is to minimize talk about the climate, and maximize the talk about the aspects of renewable energy that are consistent with his own values, which will given time result in his becoming a renewable energy advocate.

        LOCAL CONTROL of important issues is extremely important to culturally conservative and working class people, and knowing their electricity is produced locally, rather than in another state pleases them mightily . Tax revenue generated on local investments pleases them mightily. Local jobs please them mightily.

        And while the typical better educated and well informed person doesn’t really ever think much about inflation, I guarantee fucking tee ya that inflation is hot button that works extremely well when talking to working class and conservative people, because they see their incomes stagnant while their living costs are going up. It’s ok to argue that gasoline is cheap, historically, when talking to somebody making fifty or sixty thousand bucks or more, because they can still buy a tank full, or two tanks full, for an hours wages. Folks who are falling behind remember when gasoline was cheaper, rent was cheaper, groceries were cheaper, etc, in RELATION TO THEIR CURRENT INCOMES.

        Such people are quite willing to believe ( and in my opinion they will turn out to be correct in this belief ) that the prices of coal, oil, and natural gas will continue to go UP, long term, and that having wind and solar power available will turn out to be cheaper for them, long term, especially considering the local benefits of employment and tax revenue for the locality.

        Such people very seldom ever have a positive opinion of big businesses of any sort, and they are quite ready ( justifiably ) to believe that big businesses are out to screw them to the extent possible, in terms of delivering the least for the most money, so they are predisposed to stick it to the electric utility by advocating putting renewable juice on the grid.

        They are as a rule NOT opposed to the sight of windmills or solar farms, because they believe that it’s the right of property owners to do pretty much as they please, so long as they don’t harm their neighbors to any serious extent, but they might need a gentle and subtle reminder of this core conservative belief once in a while, in a public discussion.

        You don’t win a rural or small town working guy over to being a strong advocate of clean water laws by attacking businesses that provide jobs and essential goods and services DIRECTLY.

        You talk about fishing in the nearby rivers and lakes, and paying extra for cleaning up the water that his kids drink, and how it ain’t right that people up stream dump shit and piss and poisons of various sorts in the river passing thru or near his home turf.

        If you are reasonably skillful, you will soon have him repeating that old saying about the other fella’s right to wave around his fist stops short of HIS OWN nose.

        Enlightenment and wisdom come a little at a time.

        You can’t do much, if anything, to control the rhetoric of the opposition, or to control who the opposition nominates to run for office, but you CAN control your own party and coalition, to some extent at least.

        Blaming Trumpster for Clinton losing is a straw man argument. Every little kid, and every ball team composed of little kids , blames bad luck, or bad referees, or something, for losing. As the kids get older, and wiser, they come to understand that they win or lose depending on how well THEY perform. THEY can do better, but they cannot control how well the other team does.

        • GoneFishing says:

          “LOCAL CONTROL of important issues is extremely important to culturally conservative and working class people, and knowing their electricity is produced locally, rather than in another state pleases them mightily . Tax revenue generated on local investments pleases them mightily. Local jobs please them mightily. ”

          Yes, I know the type well. Saw large tracts of the last semi-wilderness in a beautiful region come under local control, to be stripped of vegetation and made into large industrial parks in the name of a few local jobs. Local resident’s land that was idle ( interpret as natural) was forcibly appropriated by local government for jobs and schools. Didn’t matter that the region was the source aquifer for much of the region or that the altitude made it vulnerable to stress. The pristine wild creek in the area now had industrial and government processed sewage and drain water pumped into it. Just can’t leave anything alone, they took what they could and wrecked, now they have a Wal-Mart distribution center and a few other warehouse type businesses. Trucks rumble into and out of an area that had once been wooded and edged several natural lakes and ponds. Guess where the pollution goes.

          There was plenty of development and business not many miles away, but the last large jewel of nature in the region got in the sights of the local politician types to make a name for themselves. Know them well. Will never set foot in their houses even though I have been invited.
          I wonder if any of the locals even got hired there.

        • Nick G says:

          there is NO NEED to mislead and manipulate them in order to keep them showing up on election day.

          If only that were true. Wasn’t greater turnout by conservatives a key element of this election, leading to almost all of the polls being wrong? If more women and young people had shown up, the election would have been different.

          IF you want his vote, you have to first talk to and about him respectfully

          Yeah. It’s worth saying again – I agree with you, respect and listening to each individual’s concerns is important in communication and persuasion.

          Blaming Trumpster for Clinton losing is a straw man argument.

          I disagree strongly. First, a trivial quibble: a straw man argument is one that isn’t realistic, which isn’t really being presented by the party being discussed, and which is easily falsified because…it’s a bad, unrealistic argument to start with. That doesn’t apply here – lots of people are indeed arguing that Trump actually had something to do with the election.

          2nd, as it happens..I’m not making that argument. I’m arguing that dishonest media had enormous impact. That’s different, and I think it’s clearly true.

          3rd, this isn’t baseball. Basic analysis is more important than developing short term tactics and strategy, which is why I’m not primarily concerned with political party tactics. I think it’s more important to have a realistic overall idea of what’s really happening in the world. Knowledge is power. If you don’t understand the basic dynamics shaping people’s ideas, you’re in trouble. In this case, if you don’t understand that people’s ideas are flying out the TV/radio speakers, into people’s ears, and then directly out of their mouth without editing….you’re handicapped.

          I don’t think you’ve quite appreciated how much influence conservative media has had in the last several decades. In particular, the perceptions on that part of conservatives that “liberal media and intellectuals” are being disrespectful, that government is bad, that local control is better…these are propaganda memes, and were mostly (not all, certainly, but mostly) created by media at the behest of their Murdoch/Koch masters who know that democracy (including independent media and national government) is their enemy.

          It’s a fundamental attack on democracy. That’s important to know.

    • notanoilman says:

      All the polls and all the statistics will not matter when Duke drops a large bribe, errrr, I mean campaign contribution into the right* hands.

      NAOM

      *Correct not political right… of course!

      • OFM says:

        http://www.nbcnews.com/news/us-news/dow-chemical-pushes-white-house-kill-risk-study-showing-pesticide-n749396

        Unfortunately bribery works all too well.

        But in the case of renewable energy and the people of North Carolina, I have some hope that they will continue to support renewables in a big way, and that this support will be adequate to force their state government to support renewables as well.

        Now about pesticides, any argument about farmers HAVING to have a given pesticide is a straw man argument, long term, although it is reasonable to phase out a problem pesticide over a few years if a substitute is not yet available, or the evidence is not clear and compelling in respect to the problem.

        As a working farmer and businessman, I passed my costs along. Farmers always pass along their costs. There isn’t any such thing as a pesticide we can’t get along without, generally speaking. If we can’t use any certain one, our yields may go down, and our other expenses may go up, but in the end……….. we pass our costs along, and consumers pay those costs.

        We can do a LOT better job regulating the use of pesticides than we have done in the past, but we CANNOT survive without pesticides now, or for the foreseeable future.

  10. Doug Leighton says:

    CLIMATE CHANGE AND RISK TO FOSSIL FUEL INDUSTRY: SUSTAINABILITY TRAIN HAS LEFT THE STATION

    Two seminal articles by energy experts in the latest issue of MRS Energy and Sustainability (MRS E&S) examine the climate-related risks facing the fossil fuel industry and conclude that the sustainability train has already well and truly left the station — and is not coming back.

    The former Associated Press Gulf correspondent finds, however, that climate changes risks vary according to different sectors of the energy industry. Demand for oil seems to be insulated from the very immediate risks facing other sectors of the industry, due to its unique role in transportation and the lack of viable alternatives, he writes. Citing a study by McGlade and Ekins, he concludes that oil reserves are the least exposed of the three fuels. Just a third of current conventional crude oil reserves would probably be abandoned to meet current global climate change targets, as opposed to half of gas and 82% of coal reserves.

    https://www.sciencedaily.com/releases/2017/04/170418160036.htm

    • Doug Leighton says:

      Meanwhile,

      CLIMATE SCIENCE BEDEVILED BY ‘TIPPING POINTS’

      “We don’t know exactly when we might pass these points or whether we already have crossed some of them…The problem is that there is no perfect analogue to what we will experience in the near future. Concentrations of CO2 in the atmosphere today are higher than any time in the last three million years, and are increasing more rapidly than at any point in the last 66 million years.”

      https://phys.org/news/2017-01-climate-science-bedeviled.html

      • GoneFishing says:

        I sometimes think that mental avoidance is a large issue concerning global warming, both anthropogenic and natural. People just do not want to hear or contemplate the changes coming even in the fairly near future.

        Humans are saddled with other shortcomings, too. “Loss aversion” means we’re more afraid of losing what we want in the short-term than surmounting obstacles in the distance. Our built-in “optimism bias” irrationally projects sunny days ahead in spite of evidence to the contrary. To compound all that, we tend to seek out information not for the sake of gaining knowledge for its own sake, but to support our already-established viewpoints.

        https://www.theguardian.com/sustainable-business/2014/nov/10/brain-climate-change-science-psychology-environment-elections

  11. HVACman says:

    Nick Schroeder – a little homework for you that perhaps could assist us in improving our climate models.

    Below is a link to the brief 600-page “Clouds and Aerosols” chapter from the IPCC’s 5th assessment report on Climate Change. Could you read through it, double-check the models, and help us find out where the heck we went wrong? We – and the world – would be forever in your debt.

    http://www.ipcc.ch/pdf/assessment-report/ar5/wg1/WG1AR5_Chapter07_FINAL.pdf

    • Leo Halstead says:

      The IPCC assessments are utter failures, if not outright frauds, considering the UN in 2015 had to admit we were on year 17 and counting of absolutely no observed increase in global temperature. Now I may not be an Oxbridge bloke, but if the climate scientists have no warming, they have no valid theory. That’s quite simple to understand.

      • George Kaplan says:

        That is an attempt at a logical fallacy called, I expect by Oxbridge blokes but others as well, proof by repeated assertion, sometimes argumentum ad nauseam – i.e. just keep repeating a falsehood until others give up bothering to reply, often the more stupid the statement the quicker others give up, and then you convince yourself you had some brilliant insight that makes you right.

        All but number 8 of the top ten years for highest temperatures have been this century. The top three, in reverse order are 2014, 2015, and 2016. The temperature increase has been accelerating. This year is likely to set a new record at current pace. Try googling “hottest years on record”, I got over 4 million results, the first few pages all seemed to have a year from this century in the title.

      • Fred Magyar says:

        LOL! No worries. There is no danger of you ever being mistaken for an Oxbridge bloke. You are either an ignorant or paid troll who is a bald faced liar, full of shit and a fucking idiot to boot! Oh, and you also have your head up your ass! Bet you wouldn’t even know how to convert fahrenheit to centigrade if your life depended on it, let alone solve the simplest of differential equation used in climate modeling. The debate in climate science is no longer about change, that has been firmly established since the late 19th century. Today it’s about the consequences of the accelerating rates of change in multiple linked non linear systems. You are a prime example of extreme Dunning Kruger syndrome.

        There’s a reason (pun intended) that scientists are marching today in Washington and cities all over this country and the world.

        http://www.vox.com/science-and-health/2017/4/19/14331168/science-march-earth-day-route-livestream-signs-speakers

  12. HuntingtonBeach says:

    The Collapse of Western Civilization: A View from the Future

    The year is 2393, and the world is almost unrecognizable. Clear warnings of climate catastrophe went ignored for decades, leading to soaring temperatures, rising sea levels, widespread drought and―finally―the disaster now known as the Great Collapse of 2093, when the disintegration of the West Antarctica Ice Sheet led to mass migration and a complete reshuffling of the global order. Writing from the Second People’s Republic of China on the 300th anniversary of the Great Collapse, a senior scholar presents a gripping and deeply disturbing account of how the children of the Enlightenment―the political and economic elites of the so-called advanced industrial societies―failed to act, and so brought about the collapse of Western civilization.

    https://www.amazon.com/gp/product/023116954X/ref=pe_2511300_235415610_em_1p_1_ti

    • OFM says:

      Hi HB,

      Are you investing the profits from your investments in oil in retirement home someplace well up on a mountain at least a thousand miles or more NORTH of Huntington Beach ?

      If you aren’t old already, you might give this some thought.

      I remember you bragging about stupid Republicans making a lot of money for you , by way of using oil.

      • HuntingtonBeach says:

        Well hi Trumpster, thank you for asking about my well being. Got a late start this morning. First thing, made it to the gym. Got 4 boxes of old business files shredded for free. Checked in on my 90 year old mother twice and had dinner with her. And this afternoon got in a nice 25 mile ride for my cardio. Beautiful sunny day in the upper 70’s. How are you ? I hope your doing well(now start voting Democrat you idiot).

        Funny that you ask about a retirement home. Because that’s the second time today the subject has come up. But it wasn’t because my current home is going to be underwater soon. When I bought the home 34 years ago, to get a mortgage it was required by Federal law that you had to have flood insurance. Almost 20 years ago, the army corps of engineers came in and spent millions of your tax dollars to rise the flood channel walls about 2 or 3 feet higher. Thank you by the way. In the mid 90’s from an El Nino winter storm, the channel over flowed and flooded the near by mobile home park in the low lying area. The elevation of the slab floor in my home is exactly 10′ above sea level(per county records). I believe the area is now rated to with stand a once in a 500 years storm. But, if the big pond out there called the Pacific rises a couple of feet and off sets your tax dollar improvement. Then we’re talking it’s just a matter of when.

        Now back in 2005 I purchased all most a half acre lot on Lake Hartwell in South Carolina to build a second home and then to maybe retirer there. It’s a beautiful lake and area. But before I ever broke ground. Your southern ways turned me off and today I just want to sell the lot to get out from underneath it. That’s about 200k of new home construction jobs that didn’t happen. But that’s not my problem. I didn’t realize at the time, you guys are still fighting the civil war. That mistake is going to cost me some money by the time I unload that property.

        Now most of my oil portfolio is in refineries. After the crash of oil prices two years ago. I’ve been picking up some producers, but I’m still mostly refiners. I have moved from pretty much a fully invested position prior to the election. To about 10% cash today. I think this current economic cycle is getting long in the tooth. The Trump rally is pretty much over and expect a major pull back/chance of recession in the near future(1 or 2 years). I’m hoping the refiners make another rally going into this summer and I’m able to unload about a third of what I have left. My cost basis is so low on the rest of the refiner stocks I own, I don’t want to pay the long term gains taxes now. Plus I also want to increase my cash position to closer to 20% and just wait for the Trump market collapse.

        So baby dog, what did you do today ?

        • OFM says:

          Hi HB,

          Yesterday was not the best of days here,weatherwise, it poured almost all day like the proverbial cow peeing on a flat rock. So I spent almost the entire day inside with my ninety plus Dad, reading some Faulkner, cruising the news, talking to old friends on the phone, working on my book. Today if the weather clears, I will enjoy a four or five hour hike taking me into the national park which is only half a mile away as the crow flies, looking for morelles.

          I made breakfast for Daddy, changed his bed, helped him bathe, and will be back in the house to fix lunch for him, and dinner as well, and do whatever else is necessary to his welfare. I hire a cleaner once a week but other than that, I’m personally doing what he did for his parents, and what they did for theirs before them, honoring my father and my mother.

          If it is within my power to prevent it, he will never suffer the indignity and pain of being taken out of his life long home and put in a ROOM in a nursing home among strangers. We have a million dollar view from the sunroom, which is where he spends almost all his waking hours, and right now, this very minute, there are goldfinches and blue jays on the bird feeders and a whitetail doe and her fawn at the far edge of the lawn, a couple of hundred feet away, enjoying the salt block I put there so as to entice them to show up more often than otherwise. The first humming bird showed up a couple of days ago.

          I’m an atheist, or technically an agnostic, but I take the moral teachings of the Christian church very seriously indeed, and put quite a bit of time into local charity work, for instance harvesting and delivering firewood to an old woman who lives half a mile down the road and really needs all the help she can get.

          This way I’m getting a three for one, doing a good deed, getting some exercise, and clearing and landscaping some overgrown hill top ground with a view which I will eventually sell to a rich yankee, assuming it doesn’t get so hot they quit moving down this way. I would rather see this community stay the way it was when I grew up, populated only by locals, mostly farmers, with houses few and far between, but I can’t stop the development, and the development puts me in a position of paying outrageous property taxes , so I find it expedient to sell an acre every once in a while to cover the taxes.

          My next recreational exercise will probably be hiking and trout fishing in the stream that passes thru my farm. I own half a mile of it, to the extent anybody owns a stream, and I have permission to fish upstream all the way to the point it gets too small, and down stream farther than I can walk and back in a day.

          My biggest on going project, other than the book, is an acre plus private lake which I am constructing personally, doing the entire job myself, exclusive of the required soil inspections. I don’t have the license necessary for that, but the engineer who did the inspection knows less about soils than I do, and admitted as much. I guess it’s sort of redneck of me, but I enjoy running big yellow construction machinery so much I have my own, lol.

          It won’t generate any cash income, but a good friend who is a local real estate agent tells me the lake will add fifty thousand bucks to the price of my place if I decide to sell. So in effect this means I will earn about forty thousand bucks tax free in equity, because I’m spending ten. If I were to stay on the job eight hours a day, I would be finished in a couple of months. That’s not enough to brag about, maybe, but it’s enough to satisfy ME.

          The lake will provide recreation and fish for the table for a thousand years to come, if future owners maintain it properly. It will have to be drained and the accumulated sediments removed once or twice per century, otherwise it will turn into a small wetland, which would be perfectly ok, other than the loss of the fish and swimming.

          Thanks for telling us again how well you are doing in the oil biz, while posing as an environmentally concerned citizen, and thus indicating how you don’t have to actually work for a living, as opposed to just managing your investments, which doesn’t normally consume a hell of a lot of time unless you are really rich.

          I have taken note of the fact you are obviously very much in favor of regressive tax law, which will allow you to rake in a substantial profit at a lower rate than clerks and cops and carpenters pay, on much less money. You’re proud of sharing that tax privileged status with Warren Buffet, who so I hear has said he pays less , percentage wise, than his secretary, lol.

          Sounds sort of Trumpsterish to me, other folks mileage may vary.

          Sounds sort of HRC ish to me. She made a habit of hanging out with rich people, and looking down her nose at those of us who are less fortunate, while arrogantly assuming the peasants/ foot soldiers of the REAL Democratic Party would continue to vote for the D party based on the fact that it USED to be THEIR party. That mistake was one ( of many) that was in and of itself enough to cost her the presidency, considering it came down to the last three Rust Belt states that put Trump in the WH. If she had had sense enough to campaign like she meant it among the real core of the D party, instead of aligning herself with the D elite, sho would have won.

          Oh, I forgot, an hour of the phone time yesterday was with a young lesbian couple talking politics. We will probably be working a phone bank together next election cycle, supporting Sanders style Democrats, REAL Democrats, organizing transportation to the polls, getting likely D voters registered .

          Ninety percent of everything I do will leave the local environment in better shape for generations to come. I plant long lived fruit and nut trees. I manage the land that’s cropped so that the depth and fertility of the soil is increasing. I deliberately create small patches of wildlife habitat designed to provide food, cover, and breeding needs of local and migrating species.

          Time and energy permitting, I will build a micro hydro plant of my own, maybe this year, that will provide a couple of thousand watts continuously,
          in order to reduce my grid sourced consumption. I’ve already built a solar domestic hot water system that works like a charm. Solar electricity is on the to do list, but I have been putting it off since the price of it is declining so fast it’s a dollars and cents no brainer to put the money into other projects for now.

          Given that you have a ninety year old mother, it seems likely old age will get you before the climate goes seriously haywire, so you won’t be NEEDING a home up north.

          I salute you for being a caring son. Altogether too many people don’t really give a damn anymore about anybody but themselves.

          • HuntingtonBeach says:

            “Thanks for telling us again how well you are doing in the oil biz, while posing as an environmentally concerned citizen, and thus indicating how you don’t have to actually work for a living, as opposed to just managing your investments, which doesn’t normally consume a hell of a lot of time unless you are really rich.

            I have taken note of the fact you are obviously very much in favor of regressive tax law, which will allow you to rake in a substantial profit at a lower rate than clerks and cops and carpenters pay, on much less money. You’re proud of sharing that tax privileged status with Warren Buffet, who so I hear has said he pays less , percentage wise, than his secretary, lol.”

            If you want respect, than you need to learn how to show it and earn it. No body gave me anything. I started at the age of 14 cleaning back inside window at a car wash for $1.35 an hour. By 16, I bought my own clothes and any food outside my parents home. I paid for my own colleges expenses and saved up for the down payment all by myself for my first home. I came from the school of hard knots.

            I’m a proud Environmental Democrat and I believe in a progressive tax system. Your a admitted Independent living with daddy. Don’t tell me what a real Democrat is. You wasted your vote on Jill Stein.

  13. Fred Magyar says:

    LOL! This one was written specifically for Caelan.
    https://xkcd.com/1823/
    Don’t forget to hover your mouse over the comic for the punchline…

    • JN2 says:

      Thanks Fred! I used vi (vim) from 1995 until I retired in 2015. Great editor. Don’t get me started on Word…

    • Caelan MacIntyre says:

      Abandonworld

      There’s this software– ‘abandonware’ I guess– called Mojoworld…
      It is sort of a semi-automatic landscape modeling software that’s apparently accurate to scale, unlike, at the time it was being developed, some or perhaps much of the landscape generation software at the time.

      The person– Doc Mojo?– who created the software has or had a nature/landscape photography hobby apparently, and I had wondered if he had some kind of epiphany and/or sudden internal conflict about mimicking landscapes inside of a computer, when there was all this beautiful landscape already all around him (that he was, if he was, mind you, ‘encoding’ onto some sort of ‘substrate’, if that’s the right word)…

      Perhaps it’s a bit like climate; modeling the (destruction) changes of what we are (destroying) changing… while on the ‘other side’ bean-counts of fossil fuel depletion continue…

      Anyway, looking at some of these Mojoworlds that users have/had created made me think of them in relation to the immediately pre-human landscapes– ‘Eden’ if you will– and in relation to the current ones, and then in relation to other software that took two or more images and interpolated between them…

      It seems like our relation to the planet is kind of like some sort of hybrid between the Mojoworld landscapes inside the computer and the real landscapes that currently have our handwriting all over them. IOW perhaps, we seem kind of trapped in an interpolative pseudoland between artificial reality and real reality.

      We don’t seem to have a full handle on either. Maybe we never will, maybe because we are not approaching either fully, and probably cannot– it’s physically impossible, since we exist in reality, if also within our minds, if also within our computers (technological constructs).

      Some of this is also a bit like typing this on ‘the computer’ to ‘Peak Oil Barrel’ and then going to and meeting and speaking with a friend at a cafe. Mind you, interacting at the cafe under a crony-capitalist plutarchy money-profit context, where one almost has to buy stuff if they want to socially interact, has its own can of worms, but we won’t open that today.

      Fred Magyar, for example, from my vantage-point is, maybe, ‘metareal’. IOW, this ‘Fred Magyar’ could be more of a ‘substrate encode’ or, say, a ‘media encode’ ‘than anything else’…

      …subject to my own potential edits… that others then may read… reinterpret and then edit again… etc….

      ” ‘The medium is the message’ is a phrase coined by Marshall McLuhan meaning that the form of a medium embeds itself in any message it would transmit or convey, creating a symbiotic relationship by which the medium influences how the message is perceived.” ~ Wikipedia

      “It’s too bad she won’t live. But then again who does?” ~ Bladerunner

      • GoneFishing says:

        The general human relationship to the natural world is destructive war. Even the educated, though they go to great lengths to justify it, still proceed with the battles.

        https://www.youtube.com/watch?v=474QL5NGgic&t=2396s

      • Fred Magyar says:

        Fred Magyar, for example, from my vantage-point is, maybe, ‘metareal’. IOW, this ‘Fred Magyar’ could be more of a ‘substrate encode’ or, say, a ‘media encode’ ‘than anything else’…

        I’m just a virtual reincarnation of the original Max Headroom…

        1980’s Some of the best max headroom quotes (from the 80’s man)
        https://www.youtube.com/watch?v=nt56RMbpq_0&list=RDnt56RMbpq_0#t=5

        Back then I was writing code to create Mandelbrot sets and dropping Acid to expand my consciousness. Twas before your time…
        .

        • JN2 says:

          Maude: What do you do for recreation?
          The Dude: Oh, the usual. I bowl. Drive around. The occasional acid flashback.

          ~Big Lebowski

  14. Rational Analyst says:

    An entire day without coal-generated electricity in the UK…first time since sometime way back in the industrial revolution’s beginnings.

    http://www.iflscience.com/environment/uk-heading-for-first-coalfree-day-since-the-industrial-revolution/

    The U.S. is being left behind…we must cater to our rube idiocracy and listen to the supreme clown-in-chief’s tweets!

    • Fred Magyar says:

      Placards seen at the scientist’s march in Washington…

      “What do atoms and Trump have in common?
      They both make up everything…”

      “If you are not part of the solution you are part of the precipitate”

      Many more gems were found there!

      • GoneFishing says:

        I think that Trump is a magnet for attention. One of the things I learned early was to not get fixated on the obvious, to look around in all directions since it is the quiet danger that gets you.
        We need to be watching the quieter ones in Congress and in business. The obvious ones are watched closely. The noisy flamboyant ones are often mostly distractions.

  15. GoneFishing says:

    Greenland ice cap is often in the news with melt ponds and cracks forming. With much of the ice cap over a mile high, the lapse rate of -0.71 C per 100 meter helps to keep the top of the ice cap cold. Despite that, melting is occurring along the more southern and western portions of the ice cap. A rare warming event as happened in 2012 can cause melting across the whole ice cap surface.
    But the lapse rate operates in both directions. As melting causes a lowering of the ice cap, it will get 0.71 C warmer per 100 meter loss. Add to the that the effect of global warming this century will have the effect of moving the ice cap about seven degrees south. The altitude factor is a definite positive feedback which will accelerate melting with time.
    The negative feedback factor is that Greenland will rise as the ice departs. Since most of the ice was lost during the Eemian, I expect that land rise is not much of a factor. So we have a fast feedback system to reduce ice in the Greenland ice sheet.

  16. GoneFishing says:

    I was wondering what the actual energy to melt the Greenland ice cap would be and if it would have a significant cooling effect. So I compared it to the ocean heat rise equivalent. The amount of heat energy needed to melt the Greenland ice cap is equivalent to reducing the first 300 feet of ocean water by 0.1794 degrees F.
    So as far as keeping the earth cool by meltwater, not going to happen especially since it will take many years to melt.
    Greenland probably does a better job cooling the earth through the altitude of the ice cap and it’s high reflectivity. Once the ice is reduced in area and altitude, the cooling effect of Greenland will be vastly reduced and just that energy change will provide more than enough energy to melt the rest without any temperature change to the ROW. In fact Greenland will become a source of heating energy rather than the cooling system it is now.

    • Fred Magyar says:

      Climate change is real!
      .

      • Hightrekker says:

        Attended a march in Bend Oregon, that was well attended, but little response from the proletariat that was driving F350’s.
        Maybe humans are just not smart enough?

        • Nathanael says:

          The lead-poisoned humans certainly aren’t smart enough.

          But since non-lead-poisoned humans are the ones who pushed lead poisoning on all of us…

        • GoneFishing says:

          Do not confuse intelligence with focus. Many of those people are very smart, they just focus on other things, often practical and realistic things.
          Show them the money, the economic advantage, in a realistic fashion and they will make it part of their reality. Just don’t expect it overnight. People need to get past their habits and egos by coming up with the ideas themselves. You just plant the seeds.

      • GoneFishing says:

        They say the rise of the Himalayas changed the global climate. What will they say when a giant plateau more than a mile high and twice the area of the Himalayas disappears?

        • Jeffrey Bromberg says:

          We’ll deal with it just like any other adversity faced in world history. Look at it this way, there are likely to be quite a few good things that come from continued warming of the planet. Besides, whether the warming is partially due to some human activities or all natural, you have to admit trying to stop it is a giant waste of time anyhow. The warming is already preordained, inevitable. Studying the rate moss dies in Alberta or the warming potential in a belch of methane is only a waste of your time and my tax dollars. Instead the entrepreneurs and innovators of the world should be the ones doing all the science. Study the future potential of growing corn in Labrador, expanding fisheries into the Arctic and Antarctic, irrigating arid parts of the world with the melt from the Greenland ice sheets, and so forth.

          • Fred Magyar says:

            Studying the rate moss dies in Alberta or the warming potential in a belch of methane is only a waste of your time and my tax dollars.

            Really now! Could you give us an exact number as to how much of your precious tax dollars are spent on such things?

            Instead the entrepreneurs and innovators of the world should be the ones doing all the science.

            Do any of you morons have any idea what science is, how it works and what kind of an education you need to have before you can actually call yourself a scientist and do research?

            You want to save your tax dollars? Stop spending all the money on useless things like nuclear armaments, cruise missiles, aircraft carriers and fighter jets! Non of those things are effective any more and can be taken out by much cheaper robots, drones AI and cyber warriors.

            The list of POB trolls just keeps growing…

            Leo Halstead
            Troy Slavski
            Nicholas Schroeder
            Jeffrey Bromberg

          • George Kaplan says:

            Most of NE Canada, including Labrador, is the Laurentian shield, which is bare rock or very thin soil, some bogs. The soil that was there got pushed south by the glaciers – it’s whats used to produce a lot of the cereal in Canada and USA today. There’s some new stuff along some rivers but not much (easy to check in more detail with google search, quite a lot of data from the provincial governments for Quebec and Newfoundland and Labrador -probably paid for by Canadian’s tax dollars)

            “irrigating arid parts of the world with the melt from the Greenland ice sheets”- that’s a new level of cornucopia I haven’t seen before – there have been studies of towing ice bergs to the middle east (probably paid for in part directly by you buying their oil). Trouble is beyond a certain temperature proteins start to denature and living things die, doesn’t matter how much water they get, and things can be great 99.9% of the time and too hot the rest – and there still is no crop (google might find more data for you – I haven’t looked).

            • Fred Magyar says:

              A stark reminder that anthropogenic climate change can cause very rapid environmental and geologic changes. Here is a clear example of a tipping point that was recently passed.

              https://www.nature.com/ngeo/journal/vaop/ncurrent/full/ngeo2932.html

              River piracy and drainage basin reorganization led by climate-driven glacier retreat

              Daniel H. Shugar, John J. Clague, James L. Best, Christian Schoof, Michael J. Willis, Luke Copland & Gerard H. Roe
              AffiliationsContributionsCorresponding author
              Nature Geoscience (2017) doi:10.1038/ngeo2932
              Received 05 December 2016 Accepted 13 March 2017 Published online 17 April 2017

              Abstract
              Abstract• References• Author information• Supplementary information
              River piracy—the diversion of the headwaters of one stream into another one—can dramatically change the routing of water and sediment, with a profound effect on landscape evolution. Stream piracy has been investigated in glacial environments, but so far it has mainly been studied over Quaternary or longer timescales. Here we document how retreat of Kaskawulsh Glacier—one of Canada’s largest glaciers—abruptly and radically altered the regional drainage pattern in spring 2016. We use a combination of hydrological measurements and drone-generated digital elevation models to show that in late May 2016, meltwater from the glacier was re-routed from discharge in a northward direction into the Bering Sea, to southward into the Pacific Ocean. Based on satellite image analysis and a signal-to-noise ratio as a metric of glacier retreat, we conclude that this instance of river piracy was due to post-industrial climate change. Rapid regional drainage reorganizations of this type can have profound downstream impacts on ecosystems, sediment and carbon budgets, and downstream communities that rely on a stable and sustained discharge. We suggest that the planforms of Slims and Kaskawulsh rivers will adjust in response to altered flows, and the future Kaskawulsh watershed will extend into the now-abandoned headwaters of Slims River and eventually capture the Kluane Lake drainage.

              If you are not part of the solution, you are part of the precipitate!

          • GoneFishing says:

            “We’ll deal with it just like any other adversity faced in world history. ”

            Yep, expanding into more primitive territory as population rose and farmland became less productive. Genocide of the indigenous population. Then wrecking much of the natural heritage of the region for profit, poisoning it, overpopulating it then building weapons of mass destruction to destroy large areas of the planet while parasitizing the new indigenous population (ceremoniously called citizens). Sure humanity will continue doing what it has done before.
            Next the Arctic and the oceans, even Greenland. Hurry though, things are changing fast so the meme of “more and more” is coming to a close. Panic! Snake will eat it’s own tail soon.

            • Fred Magyar says:

              “We’ll deal with it just like any other adversity faced in world history. ”

              According to genetic and fossil evidence, archaic Homo sapiens evolved to anatomically modern humans solely in Africa, between 200,000 and 100,000 years ago, with members of one branch leaving Africa by 60,000 years ago and over time replacing earlier human populations such as Neanderthals and Homo erectus.
              Source Wikipedia

              Compare that to WORLD HISTORY Which is about 4.5 billion years…

              To put it all in a geologic perspective, our most recent batch of trolls are dumber than rocks!

              • Hightrekker says:

                “Paging Doctor Oz! A patient calling itself The United States wandered into the emergency room disoriented, wearing a filthy warm-up suit, claiming it was “the greatest” this and that… but was unable to complete the nine-page admission protocol or present valid insurance ID. Patient is growing increasingly violent, threatening staff and other patients….”
                -JHK

              • George Kaplan says:

                Let’s see now: how did 30 to 60% of Europe deal with the black death – oops they all died; how did 6 million Jews deal with Hitler – they all died; how did the German states deal with the 100 years war – 7.5 million (one third) died; how did the world deal with Mongol invasion – 5% died; how did North and South American natives deal with the coming of Europeans – um … they almost all died; how did Chaco canyon culture deal with resource depletion – it disintegrated; how did Iceland deal with the 1783 Laki explosion – 25% died. Yep, sounds like we can deal with pretty much any problem.

                • Nick G says:

                  How did we deal with Y2K???

                  We prevented it! Rather than just letting it happen, and dealing with the consequences. That’s the smart approach. Ditto the whole idea of vaccines – prevention!

                  A quibble: “how did 6 million Jews deal with Hitler” – don’t forget the other 6 million who died: the gypsies, the gays, the political dissidents, etc., etc.

                  • Caelan MacIntyre says:

                    Y2K isn’t exactly explosions, invasions or serious diseases, Nick, however your points about prevention, and smart approaches, etc., are well taken.

                    I picked a nice spring flower for you by the way. Here; 🌷
                    It’s kind of small, but it’s supposed to be a tulip. If you use your browser’s zoom-in, you should be able to see it better.

            • Peggy Hahn says:

              Any of ya’ll have a wife or kids? I have a hard time believing it, because ya’ll wouldn’t have the time or interest to become worried sick over nonsense if ya’ll had wives and kids to give attention to.

              • Lloyd says:

                Any of ya’ll have a wife or kids?

                Uh, yeah, and we worry that they won’t make it to middle age because of the effects of global warming and coming fuel shortages.

                I’ve got a son in college, Fred has one of a similar age, Ron’s and Doug’s are grown…don’t remember about the rest, though my guess is that at least 75% of us have kids.

                Pretending there’s nothing wrong is not an example I want to set for him.

                But if you want to go ahead with your pointless superstitions and lie to your children about the state of the environment…
                you’re a typical American.

                If you want to spread disinformation, deny science, and prevent others from exercising critical thought…
                you’re some kind of evil.

              • Fred Magyar says:

                Au Contraire Mon Ami!
                It is precisely because I am a dad that I give two shits about the future. And because I have a background that made me scientifically literate, I have an inkling about what is coming down the pipeline. Unfortunately it doesn’t look all that great. Funny thing about reality, it doesn’t give a rodent’s rear end, whether or not you like it, believe it, accept it or not. It just is!

                Edit: just saw that Lloyd beat me to the punch!

                • Doug Leighton says:

                  Ditto that.

                • GoneFishing says:

                  I disagree, nature not only cares but is extremely cooperative. Seeing that we were doing so much to cause a large extinction and make a warmer world, nature was only too glad to chime and help the whole process along.
                  We could have pleasantly gone into another glaciation, but with a little effort on our part and some help from mother nature we won’t have to move south to stay warm.
                  And you thought nature was not on our side.

                  Apparently we like really sunny days and deserts too. Guess what?

              • Any of ya’ll have a wife or kids? I have a hard time believing it, because ya’ll wouldn’t have the time or interest to become worried sick over nonsense if ya’ll had wives and kids to give attention to.

                If this blog had a screen that would not allow anyone with an IQ below 75 to comment, then we would not have to put up with such stupid comments from folks like Peggy Hahn.

              • Survivalist says:

                My wife and kids are very self amusing and low maintance. As a result I have a lot of opportunities to read and pursue a wide variety of interests. I can’t imagine how having a wife and kids would prevent one from having outside interests. I’d suggest that you Peggy have just made the dumbest comment ever seen on the pages of this fine blog. Do you suppose the folks that research cures for diseases and develop new technologies are all single? Have you ever been for a drive that exceeded the boundaries of whatever inbred county it is that you live in?

                • Peggy Hahn says:

                  “Do you suppose the folks that research cures for diseases and develop new technologies are all single?”

                  Yea I would have. My mother taught me all men need a hobby, but men who stay single are the ones likely to turn hobby into obsession. Men in jobs creating things making our lives better are the ones who can only advance if they are obsessed enough, I would think.

                  • Survivalist says:

                    You’re oblivious to reality and human nature on so many levels it’s hard not to feel embarrassed for you. How you ended up taking an interest in reading the topics discussed at this fine blog is hard to fathom. I can’t imagine you having an interest in science, peak oil, geology, net energy flow, world-systems analysis, or anything outside of what might be featured on the Jerry Springer show. How’s you end up here Peggy? It surely can’t be any kind of academic or scholarly curiosity.

                  • Peggy Hahn says:

                    My brother in law moved his wife and 5 kids to North Dakota to get a job in the Bakken Oil Boom Miracle. All the good jobs here are gone, or hire only illegals/hispanics. He moved last year, but had a real hard time getting any jobs besides cashiers and janitors. I told my sister to have him lie down the bottle, keep Praying to God for help and found this web site, which I passed along hoping he would see where he could look for jobs based on where new oil was gonna come up.

                  • Survivalist says:

                    Huh, job research eh. Peculiar. Better than saying it was gas prices I guess.

                    http://peakoilbarrel.com/open-thread-non-petroleum-dec-1-2016/#comment-587866

                    My point being that it seems to me that the real people here arrived due to an interest in peak oil, whereas those that come across as anti-science sock puppets seem to have in common a claim of serendipitous discovery of this fine blog due to a somewhat tangential internet inquiry. You guys need to huddle and shake up the modis operandi a bit.

                    http://www.teamtechnology.co.uk/troll-tactics.html

                    My guess is that elements of the WUWT crowd slithered over when the non petroleum thread open up.

                  • George Kaplan says:

                    “All the good jobs here are gone, or hire only illegals/hispanics.” – maybe they prayed harder than you did, or maybe your God just likes them a bit more than you.

                  • HuntingtonBeach says:

                    PeggySue, this is the last place God would have sent you. I think you got your signals crossed. Maybe you should try planned parenthood or tell your sister to cross her legs and here her husband get a different hobby.

                  • Fred Magyar says:

                    I told my sister to have him lie down the bottle, keep Praying to God for help and found this web site, which I passed along hoping he would see where he could look for jobs based on where new oil was gonna come up.

                    Sorry, in case you didn’t get the memo… The fossil fuel industry on planet earth is in its waning days. Maybe he can still catch the next shuttle to Titan. Though if he has issues with aliens who speak Spanish, I doubt he’s going to get along with the Aliens he’ll meet at the work camps on Titan… He might want to learn Klingon.

                    yIDo’!

                  • Hickory says:

                    Peggy- For the record, I am a married man, and Ron who responded to you earlier (and founded this discussion board) just became a widower this past month.
                    And regardless of that whole issue- there is nothing wrong with having a concern about the big issues facing humanity- and discussing them.
                    If you find that odd, good for you- go somewhere else.

                  • Peggy Hahn says:

                    I didn’t do a internet inquiry to find this web site. I was reading about The Bakken on Yahoo finance and saw Ron Patterson’s Bakken articles on there.

                  • Lloyd says:

                    I didn’t do a internet inquiry to find this web site. I was reading about The Bakken on Yahoo finance and saw Ron Patterson’s Bakken articles on there.

                    The question is not how you got here…the question is why the fuck do you keep coming back?

                  • Caelan MacIntyre says:

                    It’s a Dunning-Kruger world, the best world in the solar system…

                    @Fred:
                    Klingon isn’t a real language. Don’t you know anything? If there was a language on Titan, it would more likely be called Titanium. Cuz, ya. Anyway, have a pizza: 🍕 It makes a great hat if you’re not so hungry, but just let it cool off a bit first.

                    @Peggy:
                    I was picking tulips earlier for my home and one for my Nick G, and, well, here’s one for you too. These things don’t seem to wilt: 🌷

                  • Survivalist says:

                    Came for the job search, stayed to criticize science and those that study it. That’s the lamest story I’ve heard in a long long time. Check with your line manager at the sock puppet brigade. They’ll likely have some pointers on how to improve your modis operandi.

                  • Caelan MacIntyre says:

                    💥Wow! Look at all these replies to Peggy!🔥

                  • Dennis Coyne says:

                    Hi Peggy,

                    Wind turbine technician might be a good avenue for your brother-in-law or your sister, or installing solar panels, building energy efficient homes.

                    Technical education may be a good avenue to a good paying job.

                  • notanoilman says:

                    “He moved last year, but had a real hard time getting any jobs besides cashiers and janitors. I told my sister to have him lie down the bottle”

                    I think his job finding problem can be found in a bottle.

                    NAOM

                  • Fred Magyar says:

                    Klingon isn’t a real language. Don’t you know anything?

                    Caelan,
                    Aside from the fact that a statement about catching a shuttle to work on Titan is something that most people of average intelligence would take as a hint that the entire comment was intended as sarcasm, you are wrong about Klingon not being a real language.

                    http://screenprism.com/insights/article/how-was-the-klingon-language-developed

                    By all accepted definitions of the term, Klingon qualifies as a real language. It is the structured written and verbal means by which Klingons communicate in the fictional Star Trek (1966) universe. It may not be as extensive and complete as English or Spanish, but Klingon is realized enough that fans can engage in full conversations, works of literature have been translated into Klingon, Bing offers it as a choice in their online language translation tool, and, in all likelihood, this summary of its development could be written in Klingon.

                    Don’t you know anything, Caelan?

                  • Caelan MacIntyre says:

                    Hi Fred, aside from the fact that my comment-in-question was ‘of course’ intended as casual humor and therefore– and along the lines of much humor, artistic license and all that– not quite an ‘accurate treatise’, indeed Klingon may be some sort of actual working language, and, if so, it might be fun to learn and know, if I had another lifetime to spare or, say, lived on the fictional Klingon ‘homeworld’.
                    That writ, I am happy to leave such details with you. Maybe your CRISPR can add that extra lifetime wherein we could venture to an inhabited planet where its inhabitants speak a language reminiscent of Klingon phonetics, and who would be thrilled to incorporate ours into some sort of working dialect.
                    But again, I’ll leave that to you, Elon Musk, Tony Seba and The Thought Leader Industrial Complex. “Go, Team!”

                    “Why do you resist? We only wish to raise quality of life for all species.”

                  • Fred Magyar says:

                    Caelan, without going too far down the rabbit hole, DNA is a language and CRISPR is a DNA editor. That was part of the reason I posted the XKCD comic the other day…

                    UC Davis CRISPR Mtg: Vital Role of Language in CRISPR

                    https://ipscell.com/2016/05/uc-davis-crispr-mtg-vital-role-of-language-in-crispr/

                    …Michael spoke next. He is as Associate Professor English so that brought a unique, valuable perspective. He discussed the language of CRISPR with a title of “DNA as language.” or protolanguage. He cited the “CRISPR Heroes” article by Lander and CRISPR, The Disruptor article in Nature.

                    He proposed a double major idea, such as in English (or history, etc.) and Biology. Why the separation of “The Two Cultures”? DNA is a language, not a code. The body is the text. It’s clear that he doesn’t like “editing” as a metaphor. Why? He mentioned one reason as being that editing also implies there are authors and experts.

                    When he said, “We don’t have native speakers of DNA” that kind of hit home. He also said that learning DNA is like learning Klingon. Finally, he asked, “How will we know when we become fluent in DNA?”

                    You can encode any English phrase in DNA

                    http://earthsciweb.org/js/bio/dna-writer/

                    Example:
                    GACTGTGATAGCTCATGTGATATCTACAGCATGCACCTGTAGCTAAGCACTCTCGACAGCCTACTCGTCATCCTGTGACGTAGCGAGCGTCACACTTGACTAAGCCTGCTCAGCTACCTCACT

                    You could then insert that DNA fragment into the genetic code of a living cell as your signature.

                    Cheers!

              • wharf rat says:

                “Any of ya’ll have a wife or kids?”
                Grandkids, and I’m worried sick about their future because deniers like you are working overtime to help destroy the planet’s biosphere that they depend on.

                re your reference to God, below,…

                When God created Adam, he showed him all the trees of the Garden of Eden and said to him: “See my works, how lovely they are, how fine they are. All I have created, I created for you. Take care not to corrupt and destroy my universe, for if you destroy it, no one will come after you to put it right.”

                (Ecclesiastes Rabbah 7)

          • Survivalist says:

            “We’ll deal with it just like any other adversity faced in world history.” – Jeffrey Bromberg

            Agreed, and assuming that the agenda of the gene is to select for intelligence, then I don’t think you’re going to like it, the “dealing with it” that is, very much. Perhaps the herd could use a good thinning.

            https://en.m.wikipedia.org/wiki/Population_bottleneck

        • OFM says:

          “What will they say when a giant plateau more than a mile high and twice the area of the Himalayas disappears?”

          Damned good question. The increased heat gain due to the loss of the ice over such a large area will make a big impact, no question, especially considering positive feedbacks.

          I haven’t seen much discussion of what the loss of the ice pack will mean in terms of the prevailing winds. The Himalayas are three or four times as high, and stretch out a lot of miles, and mostly block and divert what would otherwise be prevailing winds, thereby playing a truly major role in climate. I’m thinking long and high trumps surface area , in terms of climate effects, in comparing the two, but this is just a seat of the pants guess.

          If the Greenland ice cap melts, the remainder will be on average several thousand feet lower in elevation.

          This might well be enough of a change to result in changes in the prevailing winds.
          Any links discussing this possibility are welcome,and thanks in advance.

          • GoneFishing says:

            Loss of the Greenland ice sheet would effect both global and regional atmospheric circulation. Note the sentence ” Much of the world’s current pattern of rainfall would be altered.”

            Global heat transfer: The loss of Greenland ice mass would affect global atmospheric heat movement. Any heat transfer is driven by a temperature difference. The greater that difference, the faster heat flows. As the polar regions warm, the temperature difference between the equator and the poles is reduced, altering global atmospheric circulation patterns by reducing the force that drives equatorial heat energy toward the poles. Much of the world’s current pattern of rainfall would be altered.

            Regional atmospheric circulation: On average, the top 2,560 meters (8,400 feet) of Greenland is ice. Like a mountain range, this physical mass affects regional atmospheric circulation patterns. If (as) Greenland’s massive range of ice melts, regional circulation patterns will also change.

            https://earthobservatory.nasa.gov/Features/Greenland/greenland_sidebar.php

          • George Kaplan says:

            And the melt gets faster as the height falls because the surface experiences warmer temperatures at lower altitudes – not something I’d really thought about before as mile high ice mountains aren’t easily appreciated.

  17. Survivalist says:

    Warm temps and April rain showers for southern Greenland. I’m very curious to see how increased rainfall contributes to the future erosion of the Greenland ice sheet.

    http://pamola.um.maine.edu/fcst_frames/GFS-025deg/5-day/GFS-025deg_ARC-LEA_T2_max_5-day.png

    http://pamola.um.maine.edu/fcst_frames/GFS-025deg/5-day/GFS-025deg_ARC-LEA_PRCP-TCLD-PMSL_5-day.png

    As well, it will be interesting to see how pulses of fresh water impact ocean changes as the frequency of glacial aquifers rapidly draining increases, if it does.

    https://phys.org/news/2017-02-nasa-pathway-greenland-meltwater-ocean.html

    • Survivalist says:

      Furthermore,

      Amplified melt and flow of the Greenland ice sheet driven by late-summer cyclonic rainfall

      “Given that the advection of warm, moist air masses and rainfall over Greenland is expected to become more frequent in the coming decades, our findings portend a previously unforeseen vulnerability of the Greenland ice sheet to climate change.”

      http://www.nature.com/ngeo/journal/v8/n8/full/ngeo2482.html

      https://www.theguardian.com/environment/climate-consensus-97-per-cent/2015/jul/14/global-warming-is-causing-rain-to-melt-the-greenland-ice-sheet

    • George Kaplan says:

      In recent years in the Arctic there has been a persistent high temperature anomaly that has broken to significantly cooler air temperatures in May, the forecasts look like that may happen again. If not, or if the sea water warmth overwhelms everything else then I don’t see much sea ice surviving, and the excess available heat is going to hit Greenland ice.

      • Doug Leighton says:

        CLIMATE CHANGE CLUES REVEALED BY ICE SHEET COLLAPSE

        The rapid decline of ancient ice sheets could help scientists predict the impact of modern-day climate and sea-level change, according to research by the universities of Stirling in Scotland and Tromsø in Norway.

        https://www.sciencedaily.com/releases/2017/04/170424093950.htm

        • GoneFishing says:

          Since the Arctic is expected to have a 6C rise in temperature or greater, I would say that the term accelerated melting has not been fully understood as yet.
          Meanwhile the Southern Ocean and Antarctic will continue to enjoy a large input of light energy for thousands of years into the future due to orbital parameters. The minima of insolation was reached 11,000 years ago and will not be repeated for another 100,000 years.

          • Doug Leighton says:

            I agree, however, climate scientists are reluctant to drop the 6C bomb which is kind of final, like Armageddon. Saying 3C makes it all sound as if we can work things out — somehow. Greenland, at 6C, will become a collection of rocky islands and a large number of cities will be vying for the “New Atlantis” title. You know, Scuba dive New York’s Galleries and Museums sort of thing.

            • GoneFishing says:

              People generally got a snapshot of the earth during their lifetime. Things generally stayed the same until lately. Now we get to see large changes within one lifetime. We get to see the first few hundred frames of the movie “Changing Earth”. Pick a genre for that film.

            • Caelan MacIntyre says:

              “…a large number of cities will be vying for the ‘New Atlantis’ title. You know, Scuba dive New York’s Galleries and Museums sort of thing.” ~ Doug Leighton

              LOL

            • Dennis Coyne says:

              The models reproduce the polar amplification and reduced sea ice check out GISS model E

  18. Trumpster says:

    https://www.wired.com/2015/04/dmca-ownership-john-deere/

    This kinda thing just gladdens the heart of the business community, and all right thinking people who understand the proper place of the under classes,under our heels, but we need to be careful about overdoing it.

    Otherwise we might piss off some people who own machinery to the point they actually start votin’ Dimmerkrat.

    It’s one thing to fuck with a kid with a five hundred dollar phone, and it’s something else to fuck with a man with a million dollars tied up in a couple or three machines who wants to fix them himself, or hire his own mechanic.

    • Hightrekker says:

      Hey Trumpster—
      How about organizing a March for Extractive Industrial Capitalism?

      Those clever humans have already hacked Deere, and one can get the code online.

      A public station was covering it in a rural part of NorCal (not a oxymoron) .

      • OFM says:

        Trumpster sez Please provide more details, and we will send a crew to arrest the people who hacked the code, and everybody who has helped disseminate it . Can’t be having this sorta thing, it’s ‘gainst the law, and we gonna put a stop to it, and make an example.
        Trumpster sez
        Who do these stupid farmers think they are, that they own a tractor just because they paid for it? No siree, that tractor ‘blongs to the COMPANY, and the COMPANY belongs to the STOCK HOLDERS, and by God, if he wants it fixed, the stupid farmer can just call the dealer, and or let it sit out in the field and rust away.

        https://en.wikipedia.org/wiki/Digital_Millennium_Copyright_Act

        It passed ninety nine to zero in the Senate, with every Republican except one who must have been out of town for some reason and every Republican LITE so called Democrat voting for it.

        Trumpster sez we Trumpsters look after the folks with the money, and fuck everybody else, and we’re glad to have Republican Lite so called Democrats holding a few seats, they’re ok, they generally go along no problem.

        OFM is of the opinion that this sort of thing doesn’t matter very much if you’re talking about music and paying a few dollars for the right to listen to it.

        It matters one hell of a lot when it comes down to the balance of power between individuals, communities, and the synthetic immortal life form known as a corporation, which cannot be punished, cannot be jailed, which cannot feel pain of any sort, which has no built in inhibitions or morality of any sort.

        OFM says he’s too old to buy any more new equipment now, but there’s already a lot of people, including farmers and the owners of small construction and trucking companies, etc, who are making the decision to repair and refurbish older equipment after having to pay outrageous prices for service calls when new equipment breaks down, and there’s no way to get the data needed to fix it, it’s the dealer or nothing.

        Who will control the country, and the economy? The R Lite Democrats aren’t doing much to slow down the Real R’s efforts to consolidate power on Wall Street and in corporate board rooms.

  19. OFM says:

    Every once in a while, even the enemy gets something right, or has a valid criticism to offer.

    http://hotair.com/archives/2017/04/23/dnc-chair-declares-no-place-pro-life-democrats-todays-party/

    Now this is from a right oriented author, but here’s a quote any and every big D Democrat in America should read over and over, and maybe copy it on the chalkboard a hundred times, while wearing a dunce cap, IF by some chance he or she would rather WIN ELECTIONS than just bitch about how nasty and low life the opposition is.

    ” Nobody at the state and local level is beholden to either the national Democratic or Republican parties, nor are they sworn to uphold the party platform line for line. This is a lesson that the GOP had to learn the hard way after the purge in the 2008 to 2010 era. The GOP needs their RINOs, particularly the ones in the northeast, if they want to hold on to a majority in the House. The same applies to state legislatures, county commissions and school boards. It’s worth remembering that the New York GOP congressional delegation fell to a grand total of three seats during that period after previously holding more than a dozen. (We’ve been slowly recovering, but it was a rough patch for the party.)

    If the Democrats want to weed out every single candidate across the nation who opposes abortion they will be driven further into the wilderness than they are now. Pro-abortion speeches sell really well in the coastal cities where Democrats hold large majorities and raise most of their money, but there’s an awfully large swath of the country in between where that’s not going to win you an election. I get that Perez needs to appease his base during the tumultuous transition they’re currently going through, but if he’s actually interested in doing the job he fought so hard for he needs to start delivering some wins. And you don’t do that by letting the most extreme wing of your party write all of the rules.”

    There are millions and millions of people who simply will not even CONSIDER voting D because they really and truly do believe abortion is murder, or something close.

    I don’t have any problem seeing it both ways. Maybe it helps that one of my sisters specializes in keeping preemies alive, and she and her fellow professionals are winning the fight, more often, with ever younger ( fill in this blank with baby, fetus, hunk of meat , etc, as your personal prejudices dictate. )

    She believes abortion should be a woman’s right, and has counseled many young women that an abortion would be in their own best interests, but she spends most of her working days looking after babies born early.

    The real question, in terms of party politics, is this one. Which is more important, ideological purity, or regaining power ? D’s in the wilderness aren’t in a position to do much for women or anybody else, and the fewer D’s win, the more Trumpsters win.

    I don’t have any problem seeing the ideological purity argument from both sides so far as that goes. If you ( rhetorical ) stick to principles, you can hope to prevail in the long term, although you may lose in the short term. Sanders supporters lost short term, but hopefully they will prevail in the long term.

    • Hightrekker says:

      Lurking, and ready to strike:

      The ragged remnants of the neo-conservative cabal that came together under George W. Bush is still out there, plotting and scheming, concocting novel new ways to light the world on fire for power and profit. The Project for a New American Century (PNAC), think-tank mothership for every bad neocon idea that led us into Iraq and a wider conflict in the Middle East, never died; it just got new offices down the block. Unlike their counterparts in the current administration, the neocons know how the gears of government work, where the levers are, and how to actually get things done. Combine the wild fervor of Trump’s band of wreckers with the ice-eyed competence of the neocon assassins, and the result could be horrific beyond any known measure.

  20. Roger Blanchard says:

    I was asked to give a presentation for a March for Science event in Sault Ste. Marie, MI. Here is my presentation:

    We’re here today largely because there are those in denial of basic scientific knowledge concerning climate science, some who claim that global warming is all a hoax.

    The origins of this hoax date back to 1827 when Jean Bapiste Fourier published a scientific paper in which he concluded that certain atmospheric gases trap heat and warm the atmosphere.

    In the 1850s, John Tyndall made quantitative measurements of the heat trapping capacity of various gases, including CO2.

    In 1896, a Nobel prize-winning chemist by the name of Svante Arrhenius published a scientific paper in which he calculated a significant increase in atmospheric temperature due to a doubling of atmospheric CO2 concentration.

    This scientific work was achieved without the sophisticated instrumentation that exists today, illustrating that the basic science of the greenhouse effect was not that difficult to establish.

    In the 1930s, an American physicist by the name of E.O. Hulbert confirmed the relationship between CO2 and atmospheric temperature increase that Arrhenius had calculated.

    In the 1950s, a Canadian physicist by the name of Gilbert Plass, while doing work on IR radiation for the U.S. Department of Defense, concluded that some atmosphere gases absorb IR radiation, thus trap heat, one of which is CO2 and that a doubling of the atmospheric CO2 concentration would lead to a significant temperature increase.

    In the 1960s, top government scientists were warning President Johnson about global warming.

    Now the evidence is overwhelming: reduction of outgoing IR radiation from the atmosphere, increasing sea levels due mainly to thermal expansion, fairly rapid melting of glaciers and ice sheets, and increasing global temperatures.

    I monitor temperature data for SSM and numerous other locations in northern North America. In the case of SSM, in the 1970s, the average temperature for the decade was 39.77 F. For the 2010-2016 period the average was 42.94 F. If you were here in the 1970s, you should have a clear sense that it’s warmer now than in the 1970s. Locations farther north have larger temperature deviations than SSM from 1970s averages.

    The overwhelming driver for climate science denial is greed. Short term acquisitive self-interest is all that matters to some. The long-term consequences are not important.

    About 5 years ago, Kevin Anderson, one of the world’s top climate scientists, said that we had to immediately reduce CO2 emissions by 10%/year globally to prevent serious long-term changes. So far we have yet to see a decrease globally.

    What most people don’t know, or don’t appreciate, are two phenomena: thermal inertia and positive feedback.

    Thermal inertia ensures that even if we stopped putting CO2 into the atmosphere today, global temperatures would rise for many decades before thermal equilibrium was established.

    Warming will be most pronounced at higher latitudes, changing the surface reflectivity, albedo. That alone is creating a strong positive feedback. Melting of the permafrost in the Arctic and methyl hydrates in oceans, particularly the East Siberian Continental Shelf, will lead to significant degassing of CO2 and CH4, a powerful greenhouse gas.

    We may be too late already to prevent significant warming due to positive feedback from degassing of CO2 and CH4.

    One aspect of warming that isn’t well known is that many of the world’s major agricultural areas are expected to get a lot drier over time, including the U.S. On our current trajectory, Michigan is projected to be as dry as northern Texas by the end of the century. How will that affect agriculture?

    Global warming is a slow moving phenomenon but once it starts, it’s not easily stopped. It will have long-term consequences irrespective of whether people accept the science or not. Time is presently wasting away and denial isn’t helping the situation.

  21. Hickory says:

    Bloomberg news posting- that gives a version of the oil/electric vehicle issue interplay. Well done, although they forget to consider that little factor called ‘depletion’-

    https://www.bloomberg.com/news/articles/2017-04-24/the-electric-car-revolution-tesla-began-faces-its-biggest-test

  22. OFM says:

    How long it will be until perovskite replaces silicon in solar cell? Will it replace silicon?

    https://techxplore.com/news/2017-04-prudent-invest-carbon-free-electricity.html

    I’m not even a well informed tradesman when it comes to solar electricity theory and practice, so I’m hoping that somebody here knows more about this, and the likelihood of success.

    • Hightrekker says:

      removed

    • chilyb says:

      Perovskites used in solar cells contain lead and are highly water soluble. So there are some environmental questions that might to be considered. At least there would have been in the recent past.

      I am also not sure about the stability. A few years ago I heard some negative comments about this, but it may have been resolved by protecting the material from UV radiation. Amorphous silicon has proven 30-40 year real world lifetime.

      So it’s hard to imagine that perovskites can replace silicon anytime soon, but the efficiencies are very good, and may be lower energy cost to produce.

  23. Survivalist says:

    Siberian Wildfires

    http://siberiantimes.com/other/others/news/large-wildfires-and-major-flooding-as-siberia-faces-a-spring-thats-both-dry-and-wet/

    Robert Scribbler has a post up on the topic also. I like that he covers stories that highlight the current events, however some of his stuff is a bit too heavy on the hopium for my tastes.

    • Troy Slavski says:

      It’s not good for your health to only get enjoyment out of bad gloomy news. 🌧😟💊🍾😁

      • Fred Magyar says:

        Troy, you are a hapless idiot!

        Most of us here are actually realists.

        http://glowballwebnetwork.com/difference-between-optimists-pessimists-and-realists/

        A realist is someone who tends to view or present things as they really are at this moment in time. They normally don’t worry about what was (even though they are aware) and also don’t dwell on what could be. They work and live in the moment, what is currently at hand. Even stranger is pessimists view them as optimists, and optimists often view them as pessimists.

        What I found to be extremely fascinating is the outcomes that were derived from these various groups. Again it depends upon the situation, it always does which makes it hard to determine which group is best.

        Case in point; during the Vietnam conflict, US soldiers who were taken as prisoners of war and held captive undetected for long periods of time. Once our troops eventually discovered these camps and rescued prisoners, the ones who made it (long term) were often realists. In fact after looking deeper into the matter, it was discovered that usually pessimists died first, closely followed by optimists which baffled the command. They thought if anyone would make it, it would be the optimists.

        However, after further examination even the optimists who believed they would be rescued at anytime often lost hope in time and ended up giving in which resulted in giving up and their demise. Only the realists made it because they lived one day at a time and made the most out of that day, day in and day out expecting nothing more.

        • Survivalist says:

          I feel that it’s important to consider future trends, and indeed I enjoy it. The famine relief centers will be full of Troy’s and Peggy’s. Maybe they plan on God giving them the ability to shit silver dollars.

      • chilyb says:

        Hi Troy,

        Do you think Survivalist gets “enjoyment out of bad gloomy news?”

        Please elaborate.

        • Survivalist says:

          I guess what Troy is saying is that I enjoy it and it’s bad for my health. I guess that makes it a vice. I tend to think that knowledge/info is a virtue, as is a willingness to share it/post it. One thing I like about the non petroleum thread is all the great links to stuff I would usually never come across. Everything from OFM to HB to Nick G to all kinds of interesting stuff. I really appreciate what gets posted here and I hope I can somehow provide the same thing to others by expressing what interests me. Troy, as usual, has nothing but foolish opinions to share. For Troy, ignorance is bliss; a virtue. Information is bad for you. It’s pathetic.

        • Troy Slavski says:

          Well I don’t ever see him sharing good happy news here. A comment like “some of his stuff is a bit too heavy on the hopium for my taste” suggests he especially wants to see only doomy gloomy stuff. 🌩🌀🌪🔥😱

          • Troy Slavski says:

            Sorry for not having enough time to find a proper meme this time around. 😬💨🇸🇮

          • chilyb says:

            Hi Troy Slavski,

            What is your opinion of Robert Scribbler’s blog and his viewpoint on the urgency of addressing climate change? I tend to agree with Survivalist that Robert Scribbler can come across as being overly optimistic in that we have the capability to address the issue of rising emissions. Maybe we do have the capability, but not the will, as we continue to be driven by individualistic shortsighted greed. How do we solve that? That being said, I do remember Robert Scribbler specifically addressing the perception of him being overly optimistic, and he said if the optimists think it’s this bad, then we really are screwed. LOL

            Anyway, if you do have some “good happy news,” please share it. I am being very honest that I would like nothing more than to hear that atmospheric CO2 levels are not accelerating. Not all of us are about doom and gloom. But the data refuses to cooperate, despite my positive thoughts! 🙂

      • Survivalist says:

        Troy Slavski- the world’s only genius with an IQ below 70.

        My health is great. VO2 Max is through the roof.

  24. HuntingtonBeach says:

    German car manufacturer Volkswagen has imagined a friendly new shape for cars of the future based on emerging electric and driverless technologies.

    Sedric (SElf-DRIving Car) was unveiled yesterday at the 2017 Geneva Motor Show. It is the company’s first fully autonomous concept car, designed for a time when autonomous technology on the roads no longer requires the supervision of a human driver.

    https://www.dezeen.com/2017/03/09/volkswagen-sedric-concept-car-driverless-future-transport-technology-design-geneva-motor-show/

  25. George Kaplan says:

    El Nino probability had a big jump in latest Columbia ensemble analysis, up to almost 70% again. La Nina chances are almost gone now.

  26. George Kaplan says:

    Barrow (Utqiaġvik) now has CO2 in decline but it looks like certainly it hit 5 to 6 ppm peak to peak increase, compared to previous years’ showing 2 to 3 only. I think this is the most worrying of all climate trends that have had step changes over the last couple of years. Chart below is for flasks, in-situ is similar. Methane at Utqiaġvik has a similar, if smaller, uptick, as do CO2 and CH4 in other sites around the Arctic. I think there are far too many high concentrated high points for them all to be anomalous outliers. I haven’t seen any commentary on this so far in scientific journals or blogs.

    https://www.esrl.noaa.gov/gmd/dv/iadv/index.php?code=brw

    • Doug Leighton says:

      Meanwhile,

      GLOBAL WARMING MAKING OCEANS MORE TOXIC, BREAKING CLIMATE CHANGE RESEARCH SHOWS

      Climate change is predicted to cause a series of maladies for world oceans including heating up, acidification, and the loss of oxygen. A newly published study demonstrates that one ocean consequence of climate change that has already occurred is the spread and intensification of toxic algae.

      https://www.sciencedaily.com/releases/2017/04/170424153809.htm

      • Doug Leighton says:

        And, before you accuse me of Pollyannaism,

        GLOBAL OCEAN DE-OXYGENATION QUANTIFIED

        The ongoing global change causes rising ocean temperatures and changes the ocean circulation. Therefore less oxygen is dissolved in surface waters and less oxygen is transported into the deep sea. This reduction of oceanic oxygen supply has major consequences for the organisms in the ocean. Scientists have now published the most comprehensive analysis on oxygen loss in the world’s oceans and their cause so far.

        https://www.sciencedaily.com/releases/2017/02/170215131546.htm

    • Charles Van Vleet says:

      What does “flasks, in-situ” mean? Scientific code like the “hockey stick”?

      • Fred Magyar says:

        flasks, in-situ… Scientific code like the “hockey stick?

        Oh, Great! Another ignorant fucking troll who doesn’t even know how to use Google!
        Guess you never took Latin or did any chemistry or biology experiments in a lab, did you?! Whatever could a flask be?!!! Must be some deep dark code…

        Yet it’s idiots like you who have the gall to disparage science and working scientists.

        Let’s just add you to the growing list of the scientifically illiterate POB trolls!

        Charles Van Vleet
        Leo Halstead
        Troy Slavski
        Nicholas Schroeder
        Jeffrey Bromberg

        • Charles Van Vleet says:

          Look, I’m almost to my 70’s and can remember a time when people were civil and polite to others when talking in public. You must be part of the newer generations that thinks it’s okay to cuss and be rude anytime and anywhere they want. That is terrible behavior which is part of the reason why morality in this country is in such a sorry shape.

          If you actually want to help me, Yes I know what a flask is. I can remember using them back in High School biology/chemistry. I can’t say I ever seen the term in-situ or in combination with flask like in the above post. From my years reading Popular Mechanics I also know scientists like to use lots of big confusing terms the average person needs encyclopedias to figure out. That was my point with “hockey stick”. Obviously I know what a hockey stick is if your talking about the sport played on ice. Yet climate scientists aren’t going to be talking sports, but they use the term “hockey stick” anyhow in their e mails. Obviously the term means something else to them, so why shouldn’t an unusual term like “flask, in-situ” mean different things too which should be explained to those of us that don’t have careers in science?

          • notanoilman says:

            Perhaps behaving like a troll will get you treated like one. Well, I don’t have a career in science and am not of the younger generation either but it is pretty simple to understand. You have already said you know what a flask is and you did biology/chemistry; thus you should know about analysing a sample in a flask. As for ‘in-situ’ you should also be familiar with Latin from your biology/chemistry days, here is a hint
            https://en.wikipedia.org/wiki/List_of_Latin_phrases
            So, how did you get to this site? Did you use Google? If so then you could have just Googled the information.

            NAOM

          • Fred Magyar says:

            Look, I’m almost to my 70’s and can remember a time when people were civil and polite to others when talking in public. You must be part of the newer generations that thinks it’s okay to cuss and be rude anytime and anywhere they want. That is terrible behavior which is part of the reason why morality in this country is in such a sorry shape.

            BOOH HOOH HOOH!, cry me a river! You want civility?! Don’t come to a site where quite a few people are career scientists and attack their integrity, ethics and morality, not to mention their intelligence, with a constant stream of BS and statements saying that they are milking the poor tax payer of their hard earned dollars. Let’s hear you complain about military spending and the banking systems…
            .
            BTW at the bottom of that poster, those are representations of flasks
            .

        • Geoff Riley says:

          Oh, I just love the charm of this place. People here say they love science and learning for learning’s sake, but ask them to use their knowledge to explain an unfamiliar scientific concept to you and you get told something along the lines of: “go Google it, you stupid fucking idiot.”

          • Fred Magyar says:

            Oh, I just love the charm of this place.

            Fine! Then go troll some other site, you stupid fucking idiot! No one asked you to come here and insult science and scientists.

        • Troy Slavski says:

          You know nothing about me! 🎭🙅🦀⚛🇸🇮

          • Fred Magyar says:

            I know everything about you that I need to know from the content of your posts and your stupid little emoticons. You are a fucking troll, bug off!

      • George Kaplan says:

        Flask means they take a sample of air in the flask to a laboratory and analyse the contents. In situ means they have an instrument that directly measures at the sampling site, which presumably gives them more frequent and continuous measurements. Most testing around the world is through flasks, I think there are only three or four in-situ data sets, but if there are both then it allows independent confirmation of the results. Hockey stick wasn’t a code, it was a way of describing the shape of a curve, and only works for ice hockey sticks, so quite confusing for nations without much history in that sport.

    • Hickory says:

      I agree George. If this data is backed up by similar results from other locations, this is very big news.

  27. islandboy says:

    The inmates have taken over the asylum: BNEF The Future of Energy Summit kicks off in New York

    Perhaps the top event was BNEF Americas Chief Ethan Zindler interviewing professional climate denier Myron Ebell, who oversaw the new administration’s transition at the U.S. Environmental Protection Agency (EPA). Ebell began by claiming a great respect for science but disparaging climate science, and generally went downhill from there, ending in a knot of Populist paranoia about “the technological industrial elite”, scientists, California, “the managerial class”, and a range of other alleged antagonists to hard-working heartland America.

    It was truly something out of the Scopes Trial, but the joke is on the rest of us. Populism has been close to being the language of American politics since the 19th century, and these days is spoken better by Republicans. By doing so, Trump was able to put Oklahoma Attorney General Scott Pruitt as the head of the EPA, who now at work undoing years of regulation of not only greenhouse gas regulations but other regulations of pollutants in the power sector.

    I’m sure OFM will find agreement with Debbie Dooley

    De León and Dooley are at opposite ends of the U.S. political spectrum and represented very different perspectives, yet agreed on a surprising number of things. While de León affirmed that California would continue to work towards climate and renewable energy goals, regardless of the Trump Administration, Dooley did not engage in what could have been a standard partisan debate.

    Instead, Dooley schooled the crowd on how to communicate regarding energy and the environment to conservatives, recalling a lesson from her father, a baptist minister, that you have to get people into the church before you can preach to them. One of her stronger points was that while conservatives may be turned off by discussions of the dangers of climate change, that they strongly support renewable energy on the basis of energy freedom and energy choice.

    “I don’t care why someone wants to advance renewables, as long as they advance renewables,” stated Dooley. In the end, Dooley and de León ended up shaking hands in a remarkable moment of bipartisanship.

    • Fred Magyar says:

      “I don’t care why someone wants to advance renewables, as long as they advance renewables,” stated Dooley.

      Which is precisely why I like and follow, climate change denier and Trump supporter, Jack Rickard from EVTV http://evtv.me/

      To be fair, I believe Jack is married to a Filipina and has mixed race kids, so he is a bit of an outlier amongst Trump supporters but his in depth work on Tesla drive trains and batteries and his support of solar is why I listen to him.

    • OFM says:

      Hi Islandboy,

      I don’t know this Debbie Dooley, but she sounds like she has her head on straight and her eyes open.

      There are many millions of technically well educated conservatives who more or less just refuse to take climate science seriously, not because of the actual data, arguments, theory, etc, but because they are either opposed to the right left culture war, and see climate activists as being part of the enemy cultural coalition.

      There are tens of millions more who are technically more or less scientifically illiterate, who really do think the climate science community consists of nut cases and scammers out get an easy living out of the government, etc.

      ALL of these people, plus a some more millions of middle of the road people who pay almost no attention to politics, and could care less about the right left culture dispute, are generally willing to listen to any argument that is presented skillfully, meaning without pushing the WRONG HOT BUTTONS, and which indicates it’s about something with SOMETHING IN IT FOR THEM.

      One on one, I get great results talking about renewable energy, clean water laws, clean air laws, publicly funded medical research, busting up the medical, legal, pharma, energy trusts ( mostly referred to these days as oligopolies, monopolies, interlocking directorates, special interest groups, …)

      It’s no trouble at all to get an old country guy to agree with you that one reason people are so prone to have heart attacks, etc, these days is that big biz is selling them food packed with nasty chemicals, and the good ingredients separated out for chicken and hog feed, with the REST being sold as people food, and actually there is a GREAT DEAL truth in this observation. White bread is stripped of important nutrients that wind up in pet and animal feed for example.

      You won’t run up on many who haven’t learned by now by actual observation just how dangerous tobacco is, having watched friends and co workers dying younger because they are smokers, and if you handle it right, they will see the truth in the argument that while ADULTS should perhaps be free to do to suit themselves, including killing themselves indulging in bad habits, JUST MAYBE it ought to be against the law for fast food companies and soft drink companies to advertise to kids.

      You talk about how long it takes to teach the kids good habits, or good values, for instance how it’s important that the kids ( among church goers ) go to church regularly, because it takes a LONG TIME for them to really learn to honor their parents, love their neighbor, live modestly, save some of their money, refrain from drinking, etc etc, and yes all these things ARE taught in Sunday school.

      Then just carefully point out how many times they hear that old devils advertisment for soft drinks that rot out their teeth, etc, without preaching about it. They WILL understand that the government really ought to do something about advertisements aimed at kids that are designed to entice the kids into adopting bad habits.

      It blows me away that most environmental activists don’t seem to know shit from apple butter when it comes to talking to people who are NOT YET SAVED, to make a Christian pun about it. Eighty to ninety percent of everything I read in the msm is geared to the people who are already on board, namely the well educated liberalish leaning reader, when it comes to environmental activism. Half of what I read appears to be written by fucking IDIOTS determined to sabotage their own cause by way of insulting the very people they most need to connect with. They just can’t refrain from making at least ONE condescending nose in the air remark about the people who go to church, or vote R, or work in industries they would like to see shut down, etc.

  28. Doug Leighton says:

    EXTREME ARCTIC MELT IS RAISING SEA LEVEL RISE THREAT; NEW ESTIMATE NEARLY TWICE IPCC’S

    “Trajectory of dramatic climate change in the Arctic is locked in through 2050, but what happens after that depends largely on our choices today…Global sea level rise could happen at nearly twice the rate previously projected by the U.N. Intergovernmental Panel on Climate Change, even under the best scenario, according to a new report…

    “The trajectory of dramatic climate change in the Arctic is locked in through the middle of the century, when the region is expected to see temperatures at least four degrees Celsius above late 20th century averages. But what happens after that—whether the Arctic’s average temperature climbs to 6 degrees C above average or rockets to twice that—depends largely on us, the report says.

    “If the goals of the Paris agreement are met, end-of-century sea level rise would be reduced by 43 percent—or more than 20 centimeters—compared with a business-as-usual scenario, according to the report. It would also stabilize temperatures over the Arctic Ocean in winter at 5-9 degrees C above the 1986-2005 average..

    The report includes the work of more than 90 scientists from around the world, and was peer-reviewed by 28 experts. It mostly covers the period of 2011-2015, with some observations from 2016 and early 2017… One of the challenges in creating a comprehensive report about the Arctic, say some of its authors, is the pace of change there. “The problem is things change so quickly,” said Walter Meier, a scientist with the NASA Goddard Space Flight Center Cryospheric Sciences Laboratory who was an author of the report.

    The report only includes peer-reviewed work, and the peer review process can take a year or more. “The report is almost out of date before it gets published.” That said, this work reflects most comprehensive look to date at the science of the changing Arctic and its future.

    https://insideclimatenews.org/news/25042017/arctic-sea-ice-climate-change-global-warming-sea-level-rise-ipcc

    • GoneFishing says:

      One more case of reiterative mass re-agreement asymptotically approaching a consensus of conditions in a linear fashion to estimate a non-linear system. We can call this the Tantalus System, with reality always out of reach.

  29. islandboy says:

    Toyota has been showing of a hydrogen fuel cell big rig that it has developed and will be testing at the port of LA. They have a 27 second split frame video comparing the acceleration to that of a conventional diesel rig. I’m just wondering what anybody who has operated a truck of this size thinks the driving dynamics will be like. My guess is that it will be a much more pleasant vehicle to operate in terms of noise, vibration and lack of gear shifting. Economics and range of course, are a whole other ballgame. Any thoughts?

    https://www.youtube.com/watch?v=pdbT4HjzTdk

    • Nick G says:

      Fuel cell vehicles are basically electric vehicles, with an onboard generator fueled by H2. Almost all diesel trains are the same thing, except with diesel motors instead of fuel cells – diesels don’t have enough torque at low speeds.

      If the electric motor is properly sized it will be very smooth and powerful. Like trains.

  30. Survivalist says:
  31. islandboy says:

    The age of plenty on steroids (with charts)

    There are plenty of reasons to be alarmed about the future, given not only the increasingly imminent danger of Climate Change, but also the rise of new xenophobic regimes and policies in the United States and Europe. Not to mention a new U.S. Administration that has appointed directors of federal agencies who were hand-picked by the fossil fuel industry and openly deny the scientific consensus on man-made Climate Change.

    Today Michael Liebreich, the founder of Bloomberg New Energy Finance (BNEF), provided a potent counter-narrative to attendees at the BNEF Future of Energy Summit in New York City. Liebreich echoes the conclusions of many clean energy analysts, noting that despite what has been described as a “wave of Populism on both sides of the Atlantic”, that the future of solar, wind, and electric vehicle markets are very strong.

    As usual, Liebreich’s thesis was soundly backed by figures. Prominently, he noted falling costs for wind and solar, with the price of solar reaching a new record low $26.7 per megawatt-hour (MWh) in Mexico. And this is hardly limited to solar – Liebrich notes new record low prices for wind, with even offshore wind reaching a new record low of $49/MWh and merchant offshore wind in Europe. Similarly gas and oil prices remain very low, which led Liebreich to update his description from last year’s presentation of an “Age of Plenty” to the “Age of Plenty on Steroids”. This means cheap, abundant energy, and increasing portion of which comes from zero-carbon renewable energy sources.

    Nor did Liebreich appear to be phased by the Trump Administration and its “strange fetish for coal”. Indeed, he welcomed attendees to his talk as “fellow members of the Climate Industrial Complex”, a phrase from Myron Ebell’s rather paranoid interview from the previous day. Additionally, in a series of slides clearly showed how it was automation and a shift to gas that has decimated coal employment.

    Somebody (OFM?) posted a link to a documentary among the comments here recently, in which this Liebreich guy features prominently but I haven’t been able to find the comment so it might be less recent than I thought. IMO his thoughts fit well with much of the discussion going on in this thread (at least the parts not dealing with religion/global warming denial).

    • GoneFishing says:

      With Asia building more coal plants, US and Europe as well as other areas building more natural gas plants, I don’t see how any global agreement to limit GHG’s can actually be achieved. Many countries have not really started their build out of renewable energy since coal is still abundant in many regions. Where natural gas is not abundant it often can be imported.

      • GoneFishing says:

        The Saudis are talking a big game, but have far less solar PV than the small state of New Jersey, USA.

        • OFM says:

          Hi GF,

          You’ve got a point hard to argue with, the Saudis talk a lot, but so far they haven’t actually done much when it comes to wind and solar power.

          But considering their internal political situation, and practical considerations, it’s easy to see why. Changing course isn’t easy, politically, when every body is attached to the oil teat like little piglets latched onto their momma.

          And as a practical matter, they have almost for sure made the right decision, in terms of dollars and cents in their overseas bank accounts, and gold in vaults, by delaying any large scale build out of wind and solar power infrastructure.

          I’m a big advocate of everybody else who has the money to do so going renewable as fast as possible, for all the usual reasons.

          But I don’t need a CPA or even a spreadsheet to understand that it’s not in my own personal best interests to lay out ten or twenty grand for a solar system. There are other things I can do that will reduce my purchased energy consumption at lower costs, such as trading up to a newer truck, installing a heat pump, etc. I’m waiting for solar panels, inverters and so forth to get even cheaper, lol.

          The Suadis have a lot of well educated and competent financial people, and there is little doubt they have recommended putting off the investment due to the cost of wind and solar power falling so fast that delaying the investment is a no brainer, in terms of managing the country’s ( aka the royal family’s) money.

      • George Kaplan says:

        I think that is one of the big risks with promoting EV cars first – if oil suddenly jumps in price and they take off then the easiest thing to switch to for power might be more coal. Although there will be, and are, other limitations – there was a report in the UK last week that indicated in some areas here if just six cars in a street plugged in to recharge at the wrong time the local substation would fail.

        • OFM says:

          Hi George,

          I’ve often pointed out in the past that electrification of the agriculture industry is simply out of the question, out in the real boonies where farming really happens, because the rural grid isn’t up to the job, and the cost of upgrading it to handle charging huge batteries in large numbers FOR ONLY A FEW WEEKS SPRING AND FALL is more than anybody is willing to pay, at least for the foreseeable future.

          I can’t see mobile farm equipment being electrified until after the price of diesel goes thru the roof, and even then, diesel will probably still be a lot cheaper, considering the capital investment needed to switch to battery power.

          There’s a hell of difference between electrifying a car used a couple of hours a day, or less, year in and year out, just about every day, and a tractor that sits most days but runs up to twenty two hours ( two for refueling, maintenance, operator breaks ) during busy seasons. A CAR cruises on as little as fifteen or twenty horsepower, but a tractor in the field typically uses at least half the available engine power, and would discharge any given battery at double or triple the rate, or even faster, than a car cruising down the street.

          Even here in the USA, it’s my impression that the grid is not up to the job of running reasonably fast chargers on the grand scale, due to a lack of transmission capacity over the last mile or two of neighborhood lines.

          But the incentive for the power companies to upgrade is enormous. The managers are probably salivating like Pavlov’s dogs at the prospect of selling as much as twice or even three times as much juice to a given residential customer or small business, and the actual generating capacity seems to be there, if they can just get the juice delivered that last mile or two.

          And when the utilities successfully sold the idea of the “total electric” house to homeowners, they had no problems upgrading the grid fast enough to keep up with customers who gave up oil and propane for heating and cooking.

          Just about every new house built in my neck of the woods has a heat pump, and as old oil and propane furnaces wear out, heat pumps are taking their places. I haven’t heard a peep from anybody about problems with overloaded local lines.

          So- My guess is that the utilities won’t have any trouble keeping up, unless for some reason electric cars start selling a LOT faster than anticipated.

          Suppose something causes the price of oil to jump up past a hundred bucks and stay there. The only reason I can see that this might happen suddenly is a war that keeps tankers in port, but wars do have a way of happening.

          The question could come down to whether the auto companies could build electric cars faster than the utilities could upgrade the last few miles of lines.

          But while generating capacity is generally adequate for peak demand, in some places it’s already marginal, during extremely hot or extremely cold weather, and even the main transmission lines are often pretty much maxed out during extreme weather events.

          Suppose every third or fourth homeowner wants to charge his car on a night when his local utility is already having problems due to high demand for heat…………

          Hard core techno optimists are likely to argue that electric car owners can feed juice INTO the grid to help manage peak loads, and recharge during off peak hours, and under normal circumstances, this is at least technically possible.

          But an electric car has to be ready to go for the owner to go to work, and in the event of more than one day or night of extreme weather………… car to grid isn’t going to work well, if it works at all.

          Personally I think that it might be prudent to keep enough coal fired generating capacity available on a stand by basis to make sure we can and do get thru extreme weather events without blackouts. This would cost a good bit to be sure, considering that such standby coal plants would be used only a few days a year, but it would be better to pay the cost than to deal with blackouts.

          And since such back up coal plants would run only a few days a year, there’s really no reason to get all religious about the air pollution associated with running them during extreme weather events.

          China and India aren’t about to shut down domestic coal fired generation.

          • GoneFishing says:

            From Bloomberg “Climate Promises Can’t Kill Asia’s Coal Addiction”
            Asia’s demand for coal is likely to increase for years to come even though countries including China, Japan and India have agreed on steps to limit fossil-fuel pollution damaging the climate.

            https://www.bloomberg.com/news/articles/2016-11-02/asia-s-coal-addiction-seen-growing-despite-promises-on-climate

          • Doug Leighton says:

            INDIA’S OUTSIZED COAL PLANS WOULD WIPE OUT PARIS CLIMATE GOALS

            “India is facing a dilemma of its own making,” said UCI associate professor of Earth system science Steven Davis, co-author of a study published today in the American Geophysical Union journal Earth’s Future. “The country has vowed to curtail its use of fossil fuels in electricity generation, but it has also put itself on a path to building hundreds of coal-burning power plants to feed its growing industrial economy.”

            https://www.sciencedaily.com/releases/2017/04/170425140207.htm

          • GoneFishing says:

            If we went to all electric vehicles and did not make them more efficient or add new sources of power generation we would use between 10 percent and 20 percent of summer generating capacity to keep EV’s charged.
            Could end up being a a lot less in the long run since the fossil fuel industry would mostly cease to exist and all that electric power would no longer be needed. I think if all commercial, business and residential sites would switch to LED’s for lighting that would cover the rest. Commercial and industrial use 62% of the electric power in the US and commercial alone uses 35% compared to 37% for residential use.
            Businesses are lighting and power heavy, they keep lights on day and night.
            Add some insulation to reduce air conditioning use and we could power all the EV’s with no change in the system.

          • Nick G says:

            Just about every new house built in my neck of the woods has a heat pump, and as old oil and propane furnaces wear out, heat pumps are taking their places.

            Are they air or ground heat pumps? I’m very curious about the latest air heat pumps.

          • wehappyfew says:

            Why does agriculture HAVE to use big batteries to be electrified?

            We have center-pivot irrigation, why not center pivot tillage, planting, weeding, harvesting, mowing, raking, baling… etc… connected to the grid?

            • Caelan MacIntyre says:

              How about decentralizing agro and putting it around the home? Bring people to the food, instead of the food to the people? That seems even more efficient. And the plants could benefit from humans’ liquid and solid wastes too.

              • HuntingtonBeach says:

                Caelan, it’s a fair question but unrealistic expectation. There are lots of reasons why. So let me touch a few.

                Maybe the biggest reason is there are to many naysayer like Caelan in the western economy. I’m pretty sure you have criticized Nick many times for promoting EV’s. But the fact is, look how hard it is to inconvenience the public just to give up the idea of the gas station and plugging in there car. If you think a guy who works 40 to 50 hours a week and makes $75k. Wants to grow his own food, your kidding yourself. What he’s looking for when he gets home is his recliner and big screen.

                Second, most people don’t have enough land around their home to even produce 10% of their required intake.

                Yes, you wouldn’t have to bring the food to the person. But were I live, which is some of the richest soil and best climate anywhere. You would have to bring the water to the home. Here is an idea for you to help understand the difficulty of what your talking about. Go to Google Earth and follow the Colorado river from the Hoover Dam to the Gulf of California. Almost every drop of the dams release is used for agriculture. It’s just doesn’t get more efficient than this.

                Who is going to pay for the education for the public to learn how to grow their garden? 90% of the people who live around me pay a gardener to mow their yard and half of the 10% that don’t are to lazy to even to do anything.

                What I have found is the easiest realistic approach. Is to plant fruit trees around the home and mulch my yard waste to fertilize them. But, I’ll bet it doesn’t even supply 5 % of my needs, but it does supply quality tasting organic fruit for me.

        • Nick G says:

          one of the big risks with promoting EV cars first – if oil suddenly jumps in price and they take off then the easiest thing to switch to for power might be more coal.

          It’s not really a risk at all. A coal powered EV is roughly as good as an ICE, CO2-wise. And, EVs are synergistic with wind and solar: they can charge at night when wind and nuclear are often in surplus; charge during the mid-afternoon solar peak; and charge dynamically when wind is in surplus.

          So, EVs promote and pave the way for wind, solar, and nuclear.

          • George Kaplan says:

            It’s certainly a risk – if coal can power the cars and is cheap why develop any of the alternatives?

            • Nick G says:

              If utilities decide that they like coal, we’re in trouble, I agree.

              But what does that have to do with EVs?

              If anything, a growth spurt in EVs would encourage utilities to go with wind and solar, given that EVs can schedule their charging around availability.

      • islandboy says:

        “With Asia building more coal plants,”

        China Suspends 104 Under-Construction & Planned Coal Power Projects

        The use of coal in China has received heavy attention and criticism over the years, however in recent times China has begun cracking down on coal power plants and signalling heavy cuts. In October of last year, China halted construction on 30 coal power plants totaling 17 GW, ten of which were already under construction. In December, new research from China showed that China might be aiming to phase out coal imports altogether. China’s 13th Five Year Plan also committed to a coal capacity cap of 1,100 GW — though that still remained a sizable increase on the already 920 GW worth of coal the country has installed.

        Nevertheless, analysis from Carbon Tracker Initiative (CTI) of China’s 13th Five Year Plan highlighted the possibility that the country was on the verge of wasting $490 billion on unnecessary coal plants. At the time of the report in November, 2016, CTI reported that China had 895 GW worth of operating coal capacity and another 205 GW of capacity under construction. The analysis found that there was a significant chance that up to 210 GW worth of coal capacity might be completely unnecessary in 2020, if things continued apace.

        Bold mine.

        I didn’t want post the complete PV Magazine article so I omitted quite a bit. Here’ some more from the PV magazine piece:

        So Trump or no, the Energy Transition is happening faster than anyone expected. Liebreich notes that 2016 was another year where economies grew in Western nations like the United States, but that emissions did not. This is happening as the United States moved from 3% non-hydro renewable energy to 9% from 2006-2016, while China moved from 6% o 10%, and a number of European nations reached 25% or more non-hydro renewable energy penetration.

        This rapid progress is accompanied by high spot penetrations of wind and solar and is driving down capacity factors at thermal generation. As such it is driving new concerns, and the issue of grid integration of high penetrations of renewable energy is no longer an academic exercise.

        Liebreich dove into some of these issues in his presentation, noting that even huge storage will be overwhelmed by the variability of wind. That means it will be practically impossible to get rid of all fossil fuel use. He also notes that the massive volatility of very high wind and solar penetrations will mean enormous ramp rates. It will also require robust interconnections between grids.

        All of this is pretty standard for the large number of studies that have been produced to date regarding high penetrations of renewable energy. But what is more novel is that due to the success of wind and solar, we are having to deal with these issues in 2017, not 2025 or 2030.

        Bold mine.

        Call me an optimist but, it is my sincere hope that things do change faster than almost anybody expects (in terms of electricity generation and electrification of transport). There are signs that many players are about to be blindsided by massive increases in low cost solar PV generation.

        In my neck of the woods, the local electric utility broke ground two weeks ago on a new power plant to replace some of their their ancient (inefficient, oil fired) base load capacity. It is planned to use NG, shipped as LNG and supplied by New Fortress Energy, who’s news page is all about their Jamaica deal (and nothing else). The plant is a 190 MW combined cycle gas turbine which is less than a third of the island’s peak demand. As these things go, it will probably consist of two gas turbines and one steam turbine, each of which will be about 10% of peak demand, satisfying the electricity grid rule of thumb that no single unit should be more than 10% of peak demand.

        In an article covering the subject a local contributor looks at the prospects for low cost electricity going forward. A comment in the comments section does a very quick and dirty look at the financials and the future prospects for the profitability of this plant, for which ground was broken on April 7, look very dicey. In many places around the world solar and wind are putting caps on electricity prices, threatening the viability of existing thermal plants. Unless something happens to stop solar in it’s tracks, it’s only going to get worse, much worse. Good luck with that if you’re in the business of generating electricity with fossil fuels!

        • GoneFishing says:

          As a stand alone system, PV and wind can produce low cost power. If one adds in the cost of backup and storage to smooth out and fill in the intermittent nature, the costs will be similar to other production types.

          What is needed is for the users to not only become more efficient but for them to provide some storage and peak production usage. If producers would become more flexible in their charge rates, residences and businesses could install systems to use excess capacity if the rates were low enough. Right now though just the delivery charge is a large portion of the cost and that needs to go down or the system will not work. Power rates would have to be real time adjustable also.

  32. OFM says:

    I believe in free markets, about as much as anybody, when free markets actually exist, but in most industries, the biggest players have gotten so big the very term free market is more or less a joke.

    I maintain that while government should be kept as small as possible, it still needs to be big enough to deal with problems that can only be dealt with at the governmental level, such as pollution , public health, etc.

    The health care industry routinely subjects people to some pretty rough involuntary sex without benefit of a lubricant, and this is not going to change, unless it’s changed by way of government intervening, and the adoption of a new model health care system, hopefully one patterned after the systems in use in countries such as Canada, Germany, France……

    https://www.statnews.com/2017/04/20/steve-berman-drug-prices/

    I have a couple of friends who have been royally screwed by the folks who control the market for insulin.

    Stat’s a really good place to go for news about the health care industry.

    Most of us ought to have it bookmarked.

  33. Doug Leighton says:

    Good paper for anyone following Arctic climate change science:

    THE IMPACT OF CLOUD FEEDBACKS ON ARCTIC CLIMATE UNDER GREENHOUSE FORCING

    http://journals.ametsoc.org/doi/full/10.1175/1520-0442(2004)017%3C0603:TIOCFO%3E2.0.CO;2

Leave a Reply

Your email address will not be published. Required fields are marked *