Comments not related to oil and natural gas in this thread please.
A US oil export ban could raise pump prices https://www.atlanticcouncil.org/blogs/energysource/a-us-oil-export-ban-could-raise-pump-prices/ U.S. Oil Export Restrictions Coming Soon https://zeihan.com/u-s-oil-export-restrictions-coming-soon/
262 responses to “Open Thread, Non-Petroleum, December 27, 2017”
The end of the Chevy Volt is nigh! Are we on the cusp of the EV revolution, the tipping point to occur in the next few years! Rumors abound, maybe there will be enough chargers by then.
When production ends, the Volt will have fulfilled its mission of serving as a stop-gap on the path to battery-electric cars. Slow sales aren’t killing the Volt; better technology is. Chevrolet parent company General Motors is planning a veritable onslaught of 20 battery-powered cars by 2023 and it needs extra production capacity to build them.
http://www.leftlanenews.com/chevrolet-to-stop-volt-production-in-2022-99347.html
I have (leased) a 2017 Volt. I think it is a terrific and well executed design concept. To date I have 12k+ miles on it and have purchased a total of 16 gallons of gasoline. My normal daily driving is around 20-30 miles and fully charged the car will go about 50 miles in the winter and 60 in the summer. If I have a complaint about the basic car it is that the heater/AC/defrost system is lacking. That problem certainly isn’t going to be solved by going fully electric.
We have taken a few trips in the car, never more than 300 miles RT. I have casually looked for charging stations and have not been impressed, even here in California. Yes they are there but if you want certainty in getting a charge you will probably have to sign up ahead of time with more than one company providing charging stations and be prepared to spend well over an hour sucking up amps.
I do like the idea of there eventually being a world of mostly EVs. I just don’t think we are there yet.
A small, mains fan heater can preheat the inside of a car and de-ice the windscreen in minutes.
NAOM
Tesla lets you pre-condition the vehicle from a phone app. They also recently added a “camper” mode to keep the car at a preset temperature continuously. Even overnight. The mode stops if the battery reaches 20 percent of charge.
I just read tonight where the ability to heat the seats, steering wheel, and windows remotely will be in near term software upgrades per owner requests. When I had a 2013 Volt I also noticed the heating was not quite as robust as I wanted. The Tesla S and X does very well in comparison. As it should for the price. I hope the Tesla 3 does as well.
Had to laugh when the last software update added a “chill” acceleration mode to make the vehicles not accelerate so quickly. So now they have chill, standard, and ludicrous acceleration modes. Standard is way fast enough for me, while chill is handy for snowy days.
I just don’t think we are there yet.
JJHMAN.
You are the master of understatement.
Out of what will be over 17,000,000 sales only 105,000 were electric vehicles.
https://cleantechnica.com/2017/09/09/usa-fully-electric-car-sales-82-2017/
In 5 years time perhaps a million will be sold out of 17 million.
I wish it would be more, but batteries cars have a long way to go to be as convenient as petrol cars. Which you can fill up in 2 minutes, drive over 300 miles between fills. not have to worry about installing a charge point etc.
I think hydrogen is a far more promising technology.
https://www.riversimple.com/
Ever heard of Tony Seba? If not, you should look him up on Youtube! Just in case you cant be bothered, in 2014 Seba published a book, ” “Clean Disruption of Energy and Transportation – How Silicon Valley Will Make Oil, Nuclear, Natural Gas, Coal, Electric Utilities and Conventional Cars Obsolete by 2030” and on Sept 19th of that same year a presentation he made to the AltCars Expo in Santa Monica, California was recorded and made available on Youtube.
His most recent edition of what is essentially the same presentation was recorded on June 8 at an event hosted by the Colorado Renewable Energy Society in Boulder, Colorado. In his more recent presentations he has moved his date forward by five years to 2025 based on the fact that progress is being made at a faster rate than he anticipated. He bases his projections on technology cost curves.
According to the Monthly Plug-In Sales Scorecard at insideevs.com, 95,507 plug in cars were sold in the US in 2013, 122,438 in 2014, 116,099 in 2015, 158,614 in 2016 and sales are on track to exceed 200,000 in 2017. You can probably double the 105k sales figure for the full year and the same article you cited is suggesting an 82% increase in 2018. Bear in mind that Tesla alone plans to make 10,000 cars a week by the end of 2018 so I would venture that plug in sales could hit the one million per year mark in less than three years.
As for your opinions on hydrogen, according to this Bloomberg article, “California Doesn’t Have Enough Charging Stations to Hit Its Electric Car Goals”
“In 2018, state regulators will weigh proposals from investor-owned public utilities Pacific Gas & Electric, Southern California Edison, and San Diego Gas & Electric to bill customers more than $1 billion to electrify California’s transportation sector. Utilities plan to install more than 100,000 charging locations at apartment houses, in businesses, and along highways. As of October, there were about 13,822 public charging spots in the state.”
According to an article in the New York Times, under the headline, “First Came the Hydrogen Cars. Now, the Refilling Stations”, there are 30 hydrogen refilling stations in the state of California and ” The state recently provided $32 million in grants to fund the construction of 15 additional fueling stations.” Doing some quick arithmetic, EV charging points are looking like $10k per station while hydrogen refueling is looking like $2million per location. It doesn’t cost $10,000 to install a 30 Amp 220 Volt (6 kW) socket in your garage for your EV but, don’t worry at two million a pop NO ONE will be worrying about installing hydrogen refueling at home! Promising technology my foot!
islandboy
I never said individuals would install hydrogen filling stations in their homes. If you need to misrepresent what someone says in order to make a point, what does it say about you?
Did I say that you “said individuals would install hydrogen filling stations in their homes”? I was merely illustrating that, while a standard 50 Ampere, 240 Volt socket, such as those used in the US for cookers, might be a somewhat inconvenient expense, such a proposition pales in comparison to the cost of building a single hydrogen refueling station. The fact is, it is not outside the realm of possibility that someday, the vast majority of parking spots will have a socket to plug in an EV. The basic infrastructure (electricity supply) exists almost everywhere. The infrastructure for producing, storing, distributing and retailing hydrogen for millions of hydrogen vehicles will have to be developed and there are a fair amount of issues to be dealt with, not the least of which is cost.
What do you think of Seba’s videos?
Seba in 2014 was far too optimistic. His predictions are way off the mark.
A small electric vehicle like the leaf costs £30,000. A petrol car of the same size, will cost you £13,000.
The difference in price will pay for all my petrol, insurance, road tax and servicing for 7 years.
The choice is not difficult for me.
What car do you drive?
“What car do you drive?”
Hopefully, in less than a months time it will be the same as the one in the picture below.
I cannot see what make or model that is.
Is it electric?
It’s a Nissan e-NV200. It’s a cross between the regular NV200 light commercial van with the battery, drive train and control electronics from the Nissan Leaf. In Europe they are manufactured in Barcelona, Spain. The one I’m trying to get is from the Japanese domestic market and is already in the island (not cleared from the wharf yet). The dealer said used Japanese units wee less expensive than those on the used market in the UK.
Incidentally according to this page the 2018 Leaf starts from £26,190 (£21,690 with the £4,500 incentive). According to this page the closest equivalent costs £13,275, £7915 less than the Leaf.
In my case, I’ve already invested in a lifetime supply of free fuel, a 5kW grid tied PV system, so the EV is just part of my master plan. De-carbonize.
I guess what one considers convenient is subjective.
Never having to stop at a gas station because your car is ‘full’ every morning sounds very convenient. No oil changes, few, or no brake jobs, and little maintenance requirements all sound quite convenient too.
Bob
In many streets, houses have no driveways and it is impossible at the moment to charge an electric car.
The only way people will buy an electric car in streets like that is for the council to install dedicated bays for electric vehicles. These bays would need to have a fee so people do not take up a valuable parking space when they do not need to charge their car.
Electric vehicles are a good option for families that have off street parking, but in England fewer than a third have that luxury.
For the rest being able to fill up in 2 minutes is the only option and hydrogen could provide that option.
If there were sufficient hydrogen filling stations, many people would opt to buy a hydrogen car.
Hydrogen and electric vehicles will only become mainstream when charging and refueling is made available.
Hydrogen will never become mainstream.
The Hydrogen Hoax
As far as usable fuel is concerned, what we have managed to do is trade seven moles of methane for twenty moles of hydrogen. Seven moles of carbon dioxide have also been produced, exactly as many as would have been produced had we simply used the methane itself as fuel. The seven moles of methane that we used up, however, would have been worth 1435 kilocalories of energy if used directly, while the twenty moles of hydrogen we have produced in exchange for all our trouble are only worth 1320 kilocalories. So for the same amount of carbon dioxide released, less useful energy has been produced.
SNIP
The idea of producing hydrogen via water electrolysis locally at filling stations is equally preposterous.
That part of the article is far too long to copy and paste here. But if you are still so delusional as to believe hydrogen cars are the wave of the future, you should read it.
While naysayers like Zubrin are telling us what can’t be done there are people who are actually doing it.
http://www.itm-power.com/project/wind-hydrogen-development-platform
Instead of excess wind power being dumped, it will be used to power transportation.
For the rest being able to fill up in 2 minutes is the only option and hydrogen could provide that option.
Well maybe, maybe not!
https://www.youtube.com/watch?v=nst2RGtgzfk
Shell Recharge | Fully Charged
Published on Nov 9, 2017
A rapid charger in a Shell forecourt, in the middle of London. I never thought I’d see that. Well, it’s happened, you can use it today.
Will electric car drivers use them?
Will Shell install loads of them?
We certainly hope so.
More info: http://www.shell.co.uk/motorist/help-…
That is the way forward. Having charging points where people park for some time is essential. Such as shopping centres, motorway service stations and general carparks.
I cannot think of one carpark where a charge point is located.
High Peter,
If the price of batteries continues to come down as predicted by the people in the industry, who ought to know, lol, in five years time an electric car can be sold only a very little more than a comparable ( size, style, overall quality, comfort and above all STATUS in the mind of the purchaser ) conventional car.
I’ve worked in and around manufacturing industries for almost half a century, off and on, a few days, a few weeks or months, as a multicraft tradesman performing various maintenance work. I ‘ve even worked production, when I couldn’t find anything else, a coupe of times. Bottom line, I think I’m as well qualified to claim the title of world class jackass of all trades as just about anybody, lol. I’ve SEEN what I’m talking about.
Improving efficiency across the board is the basic rule of survival in any manufacturing or materials processing industry. A SURVIVING modern Yankee furniture plant turns out probably three times the production per worker, with three quarters or less waste, per finished piece, as it did forty or fifty years ago. The stuff that used to be waste, mostly small pieces of wood and saw dust, is now raw material that goes across the street and comes back as composite lumber and goes right back into the production line.
The modern day battery industry is just now about at the eighth grade level when it comes to growing up and flexing its muscles and playing ball.
The market wasn’t really THERE for long lasting rechargeable batteries until the last decade or so. Markets create themselves, in a very real sense, sometimes. Nobody except well heeled early adapters who expected to use them on a daily basis could afford the first generation of hand held battery powered drills and saws. Now that the price of these smaller batteries has fallen far enough, it’s pretty much the rule, rather than the exception, that anybody working in a trade requiring hand held power tools has some of them, even if they are needed only once in a while. A typical suburban homeowner has a set.
And the more they sell, the greater the incentive to build new manufacturing facilities, second , third, fourth generation facilities that produce more and better quality batteries using less materials year after year.
Matt Simmons was maybe a little ahead of his time, when he famously said that rust and depletion never sleep.
There’s only ONE way, barring the world wide economy falling apart, that oil and gas can STAY cheap. That’s if electric cars get to be popular enough to cut far enough into the consumption of oil to offset the inevitable decline of legacy production.
I haven’t seen any good NEW numbers, but I’m thinking that if I lived in anywhere gasoline taxes are high, and needed to drive fifty miles round trip per day to work for the next ten years, I could afford a Chevy Volt, without ANY subsidy, based on what I would save on gasoline, NOW.
Let’s not forget that if you take good care of it, and put two hundred thousand miles on it almost entirely on battery power, it will still have a functionally brand new engine under the hood, lol.
So….. a well cared for new Volt is an excellent potential bet to run four hundred thousand miles without any really major repair and maintenance expenses, other than new tires and such, the first half of it’s life.
I’m not betting against hydrogen, in purely technical terms. Fuel cells may get cheap enough to out compete batteries, especially in heavy trucks, farm and construction machinery, and so forth, when it’s important to be able to run all day and maybe all night too for days or weeks on end.
But the battery industry appears to have at least a ten year head start on the fuel cell industry.
And there’s no infrastructure to distribute hydrogen to millions of motor vehicles.
Mains electricity is available at probably ninety nine percent of all the places you can go with a car in the western world.
The electricity industry is DUG IN, as much or more so than any other industry in the world, even the oil industry. The companies that own it are MORE than ready to supply as much as their customers are willing and able to pay for. They’re drooling at the prospect, lol.
I can’t see hydrogen displacing batteries, OR gasoline and diesel fuel, on the grand scale. in less than fifteen or twenty years.
I’m not betting against hydrogen, in purely technical terms. Fuel cells may get cheap enough to out compete batteries, especially in heavy trucks, farm and construction machinery, and so forth, when it’s important to be able to run all day and maybe all night too for days or weeks on end.
It is not the cost of the fuel cell that continues to kill any hope of a so-called hydrogen economy or hydrogen car. It is the cost of producing and delivering the hydrogen itself.
Why a hydrogen economy doesn’t make sense
“More energy is needed to isolate hydrogen from natural compounds than can ever be recovered from its use,” Bossel explains to PhysOrg.com. “Therefore, making the new chemical energy carrier form natural gas would not make sense, as it would increase the gas consumption and the emission of CO2. Instead, the dwindling fossil fuel reserves must be replaced by energy from renewable sources.”
While scientists from around the world have been piecing together the technology, Bossel has taken a broader look at how realistic the use of hydrogen for carrying energy would be. His overall energy analysis of a hydrogen economy demonstrates that high energy losses inevitably resulting from the laws of physics mean that a hydrogen economy will never make sense.
For every 100 KWH of electricity used to separate and deliver hydrogen from water, only from 19 to 23 KWH are delivered to the drive train.
Hi Ron,
Personally as a betting matter, I’m with you, for now and for the next decade at least. Probably two decades. Past that?
I don’t see the price of hydrogen falling far enough to make it competitive as fuel in mobile applications even for big trucks or farm and construction machinery within the next ten or twenty years, for sure.
But there’s a possibility that I’m wrong, because unless the economy crashes sooner, in ten to twenty years we are going to have enough wind and solar power available any time the weather cooperates that we may be able to use the surplus to run a hydrogen production industry.
It’s impossible to say, now.
But if the cards fall this way, then it wouldn’t be necessary to have a near universal hydrogen distribution system such as we have already for electricity and gasoline and diesel fuel.
The vast majority of all the fuel that’s burnt in commercial trucks is pumped into them in a very few fueling stations on busy highways.
At the one nearest my place in Caroline county in Virginia on I 95, twenty years ago, as many as twelve trucks at a time were refueling pretty much around the clock and around the calendar. It was rare to see fewer than six at the pumps.
Each one averaged about ten minutes at the pump, and a typical purchase was between one hundred and two hundred gallons.
I’m willing to make a wild assed guess that there are at least five hundred gasoline pumps at retail stores for each diesel pump at a truck stop. And an average gasoline purchase is probably not much over ten gallons.
Getting hydrogen to truck stops and farms might turn out to be feasible, if it’s cheap enough.
Lots of farmers have big propane tanks already. Maybe in twenty years big hydrogen tanks will be cheap enough for farmers.
And there’s no way of really knowing how cheap the equipment needed to manufacture hydrogen ( from water ) may be two or three decades down the road. A farmer may be able to afford one, lol, and run it any time his local utility can supply him with dirt cheap wind or solar power. I never thought when I was a kid that machines such as air compressors big enough to run power tools all day every day would ever be cheap enough that just about any two bit farmer would ever own one. But I do, and it was cheap enough new that I could easily afford it even though I knew it would seldom be used more than a couple of hours at a time.
And when I went on my first tour of campus at Tech, where I eventually took my degree, and was allowed to look thru a locked glassed door at a computer that was as big as my house, probably bigger, I never dreamed that I would own one capable of doing not only as much, but a hundred times MORE, lol.
But the one I’m using right this minute cost me only a hundred and twenty bucks, delivered, including sales tax. It’s a refurb, but it has Windows Ten. It can do a hundred times more.
It’s diesel and gasoline for now and for the next ten years. In ten years there will be enough electric cars and light trucks, maybe some heavy trucks, on the road, to really matter.
Sometime after that , we might start seeing some significant growth in the mobile fuel cell industry. If so, it will probably be ANOTHER ten years before fuel cell cars and trucks get to be common enough to really matter.
It simply does not matter if the hydrogen production process is extremely inefficient in terms of energy in, compared to energy out, if the energy used in is SURPLUS, if there’s no other good use for it.
The combination of a fuel cell plus an electric motor is very efficient, in and of itself. This can go a long way towards offsetting the energy lost in producing hydrogen.
When a company as big and as well managed as Honda is willing to spend megabucks on fuel cell tech, it’s a given that the engineers working on it, and the management that hires them, believe fuel cells are a good solid bet.
Hi Oldfarmermac
If renewable energy is to fully replace coal and gas, then there will be huge amounts of excess electricity.
Take Germany for example.
Germany has a peak demand of around 80Gw
https://www.agora-energiewende.de/en/topics/-agothem-/Produkt/produkt/76/Agorameter/
It has 55Gw of installed wind and 42Gw of solar.
https://www.energy-charts.de/power_inst.htm
On an annual basis all those turbines and panels only produce about 26% of all production.
The problem as you know, wind and solar output varies a great deal, sometimes they produce only 3% of demand and sometimes as much as 60%.
If installed capacity were increased in order to provide close to 100% of Germany’s annual electricity demand, then that would require around 350Gw of installed power.
Installed capacity of that amount would mean excess production occurring approximately half the time. Obviously this would require electricity storage systems on a scale few really appreciate.
Since Germany wants to get rid of Nuclear power, all coal generation and eventually all gas. In a week such as week 48, Germany would have to be able to store enough power to make up the shortfall over the 4 days of little wind and sun.
https://www.energy-charts.de/power.htm?source=all-sources&week=48&year=2017
If a home needs 1 powerwall for 24 hours.
https://www.tesla.com/en_GB/powerwall
what would a hospital, rail system and country need?
Only hydrogen can ever store enough power for 2,3 or more days.
ALASKA’S ARCTIC NATIONAL WILDLIFE REFUGE IS NOW UP FOR SALE
Wake up, America. The Republican tax bill just gifted one of your most treasured national landscapes to oil companies. Against any measure of public interest, and in defiance of plausible economic reason, the new law mandates oil drilling in Alaska’s iconic Arctic National Wildlife Refuge. This is a gift to Alaskan politicians and an unneeded bonus for the world’s richest corporations. It must be stopped. The refuge, as many Alaskans reverentially call it, has been steadily targeted by Alaska politicians for decades. Its federal protection came in 1960, when Republican President Dwight Eisenhower formally recognized its national importance, preserving its “unique wildlife, wilderness and recreational values.”
http://thehill.com/opinion/energy-environment/366568-alaskas-arctic-national-wildlife-refuge-is-now-up-for-sale
It must be stopped.
Maybe by the end of 2018.
Before that, it is “rape and scrape”.
And 2018 is not a given.
When a person continuously pursues harmful and nonsensical actions it’s called criminal insanity.
When a government does it, it’s called agenda and progress.
When a government does it, it’s called agenda and progress.
I consider the current US government to be illegitimate, It was not put in place by democratic means, It is the result of a coup d’état by the fossil fuel interests joining forces with authoritarian foreign oligarchs who manipulated enough Americans to vote against their own interests to put them in power. While it certainly has an agenda, it is the antithesis of what one might call progress. The good news is that true progress is happening throughout the rest of the world and is prevailing against these forces even here in the US.
If we had little use for fossil fuels, there would not be these problems. In fact preserved areas would grow.
It is the duty of any moral and thinking being to stop the use of fossil fuels.
That is only one of many destructive memes we need to correct.
I do not know how much harm will come to ANWR but I do think that this will rev up the Eco-War and force many more to take active sides. There is no winning when that happens, since we need to band together now and tackle the many problems we already have, not be wasting time, energy and materials on a distracting battle we can not win.
Further division now amongst people will only exacerbate the predicaments we are already deep within.
But the war will be fought. Up until now it has been mere skirmishes, but the fear is building on both sides and the middle will be in confusion. One more chaotic situation in a world we never really protected, where people think everything is up for grabs and there is no safe place.
I have seen much destruction of the environment in my lifetime and have marveled at how much has been protected or at least preserved against the machines of destruction (development).
However, if what has happened, in my very own neighborhood, to life in general happens worldwide, we can kiss it all goodbye. The changes happened silently, less fish, less bugs, less birds, less life. Most of the change happened within a decade and now it is appallingly obvious. A mostly forested area with lakes, ponds streams and relatively low population just dying. The plants seem to be fairly stable, even highly productive some years, but the animal life, big and small is grossly reduced.
Guess what? After a warm winter the tick population which has been growing should have increased further. It appears to also have dropped dramatically this year.
This is not a closed system, there are natural and forested regions all around me so if this were a one off event the life should have filled in again. It did not.
The songs of birds in the spring, so many species are not heard here now that I used to hear. I am out at least four times a day wandering the dirt roads and woods from dawn to well after dark. Even the spider population is very low.
When I think about it, I know what an extinction event really looks like. The small dies, you don’t even notice it much at first, then much of the rest leaves or dies too. The world is still green, but not fully alive anymore. No bugs on that grand collector, the windshield? Not anymore. One should not see this in a lifetime, let alone a decade.
The same is happening in parts of the ocean.
So while we squabble over the last of the oil, the last of the coal and gas and whether or not to use it; the rest of the world is dying and changing at a fast pace. The world is being poisoned in many ways, some which we don’t comprehend, others that we daily ignore.
Sometimes I wonder if there is another lifetime left. If there is, it may be a very lonely, quiet and sterile one. The sounds of EV’s and the hum of transformers will fill the space. Maybe people will place little electronic birds in the trees that produce little electronic songs and chase robotic crickets. Children will try to catch mechanical fish in the lakes and bugs will just be things that listen in our conversations.
Oh how my soul aches to go back to the bliss of my great-grandparents time when they could go down to the creek to wash their clothes against rocks and take their monthly baths in the muddy water. Well, at least the world was colder then.
I agree with you Fred
And…Doug,
Trump just issued/signed and Exec Order removing drilling oversights installed after Deepwater Horizon. I read yesterday this would save oil companies 900 million over the next 10 years.
And how many billions did BP spend in crisis management, fines, cleanup, and remediation? Talk about Tragedy of the Commons, for the profits of a few shareholders and bonuses for the execs. Probably big contributors to the Republicans. MAGA, and drill baby drill.
The government can mandate drilling in ANWR but it cannot make the oilmen drill there. The coastal plain is exactly that, moss and willows with many layers of wet permafrost underneath. Permanent structures like drilling rigs will eventually sink like my cabin north of Fairbanks, also sitting on melting frost. Climate change has made Alaska warmer so the permafrost will melt even more rapidly. The oil companies are run by folks who have to face reality not wishful thinking. My guess is the oilmen will think awhile before paying the enormous expense of drilling in ANWR.
Looks like a lot of pipeline and structures are there already when I look at Google satellite map of the area near ANWR. Does resemble Swiss cheese though.
http://dog.dnr.alaska.gov/Documents/Maps/ActivityMaps/NorthSlope/NorthSlopeOilAndGasActivityMap-201511.pdf
Using gravity to watch a changing earth
https://media.ccc.de/v/34c3-8964-watching_the_changing_earth
Relevant background to anyone with a closer interest in climate change research. Unfortunately only 30 minutes long.
Thanks Gerry. Nice find.
Yes, great talk. Though I have upon occasion opined that anthropogenic climate change skeptics tend to doubt the effects of the law of gravity, or find it so inconvenient that they endeavor to repeal it.
Standby for some of our local trolls to wade into the discussion with some contrarian unscientific opinion discrediting the rather stark but obvious conclusions from the talk, that only give added weight, or should I say mass, 😉 to so many other studies telling us we need to stop burning fossil fuels yesterday!
30 minutes is really long, if you are looking for the general population to care. Better would be 15 second clips to share around social media hoping to go viral. I think ad agency research showed 10 or 15 seconds is the ideal time you want, if you want someone to pay attention to your message, otherwise they just tune out or skip it.
30 minutes is really long, if you are looking for the general population to care.
Most here already have a pretty decent level of education and attention spans that generally exceed 15 second sound bites. While ignorance is not a criminal offense, deliberate ignorance due to being too lazy to take the time to acquire some generally available knowledge will probably disqualify some members of the general population from such discussions as take place on this forum. By that I mean those that lack at least a high school level of math, physics, chemistry and biology. That really isn’t too much to ask.
Yes 30 min is really long, if you’re a fucking idiot.
Even the spider population is very low.
Yep, if there are no insects they have nothing to eat. I’ve noticed that the orb weavers have mostly disappeared from the paths where I walk.
I did find this little guy hunting on my car the other day
.
If we want to know about population crashes we just have to actually look at our fellow creatures.
Just a few years ago I would walk at night in the spring and thousands of little eyes would glisten back at me, from as far into the brush and woods as my LED headlamp would reach. Would be enough to give most people the creepy crawlies. This year, very few spiders.
The moths that used to fly around the two streetlights in the area were missing too. Now that I think about, very few wasps. I have read about firefly populations crashing in some areas. I did see some this year, but not very many.
It’s very disconcerting to have so many creatures that one grew up with just vanish, but they lead short lives and can depopulate quickly. If people think things are not changing, I just wonder if they have any powers of observation.
What have we unleashed upon the world? It can’t be climate change that is doing this. It’s got to be our chemicals.
What have we unleashed upon the world? It can’t be climate change that is doing this. It’s got to be our chemicals.
I’ll bet it is a complex synergistic sum of factors which probably include the cocktail of chemicals we constantly release directly into the environment. We test for toxcicity to humans for individual drugs and chemicals but really have very little idea how the thousands of chemicals we use daily interact with each other once they enter the environment. Then we have environmental pressures such as habitat loss and habitat fragmentation. Droughts, floods, massive wildfires and temperature extremes caused by climate change on top of all the other things must certainly have some effect as well.
https://e360.yale.edu/features/insect_numbers_declining_why_it_matters
What’s Causing the Sharp Decline in Insects, and Why It Matters
Insect populations are declining dramatically in many parts of the world, recent studies show. Researchers say various factors, from monoculture farming to habitat loss, are to blame for the plight of insects, which are essential to agriculture and ecosystems.
“We test for toxicity to humans for individual drugs and chemicals but really have very little idea how the thousands of chemicals we use daily interact with each other once they enter the environment.”
Therein lies the rub. Friend of mine is a fire chief of a small town (about 10,000) who insists its not the chemicals (and plastics) we know, its the new ones created in in the caldron of a fire that get you — deadly toxins we know nothing about.
I think it’s the new herbicides and pesticides introduced over the last two decades. Fires have been around for a long time, but areas that don’t have much fire are dying off too.
Chemical analysis can easily be used to determine the compounds produced in fires.
The burning of treated wood is dangerous, less so now that arsenic has been removed from the process, but still nasty.
http://web.mit.edu/parmstr/Public/NRCan/CanBldgDigests/cbd144_e.html
Just the burning of wood in wood stoves produces enough particles and carcinogens to kill people. Wonder what it does to the smaller creatures.
http://www.burningissues.org/car-www/science/pah-comp-wood-coal.htm
I think Doug was referring to fires in buildings. However the point remains. The whole can apparently be much greater than the sum of the parts… we don’t have a lot of studies on how all the chemicals we use interact with each other and therefore have unknown and possibly unintended consequences.
https://www.ncbi.nlm.nih.gov/pubmed/12049388
An analysis of the combined effects of organic toxicants.
Chen CY1, Lu CL.
https://www.beyondpesticides.org/assets/media/documents/infoservices/pesticidesandyou/Winter%2003-04/Synergy.pdf
Synergy: The Big Unknowns of
Pesticide Exposure
Daily combinations of pesticides and pharmaceuticals untested
Fred, the first link was for buildings burning. The second for wood burning.
Studies on the breakdown of plastics in the environment indicated hormonal analogs were formed. Yet even with this knowledge, nothing was done about it.
We don’t even have much information on the chemicals themselves let alone the possible combinations.
http://www.chemicalindustryarchives.org/factfiction/testing.asp
“Chemical analysis can easily be used to determine compounds produced in fires.”
Not really: “Information on toxic gases and vapours produced by combustion of materials commonly found in buildings is still very limited. Some quantitative data on the toxic compounds are now available, but data on many other toxic combustion products produced in small quantities are very scarce. Knowledge is also lacking of differences in burning rates (and resulting rates of production of toxic gases) of materials under comparable conditions of burning and differences in rates of condensation of products as they migrate away from the fire.”
Yes, really. That article was produced in 1971. I was an analyst for many years and believe me, the current state of the art is fully capable of determining all the products of combustion, organic and inorganic. There was a huge increase in analytical technology, methods and speed of analysis post 1971.
“It’s all about the plastics,” says Mark Johnston, president of Fire Fighters Local 452 in Vancouver, Washington. “Fifty or 60 years ago, when a house caught on fire, it was all wood and natural materials. Now it’s all plastic. Think about your house. Your clothes are all synthetic, your carpet is all synthetic, even the wood trim is not wood trim any more.”
When today’s houses burn, the resulting soot, mists, and fumes contain chemicals like benzene, methylene chloride, perchlorethylene, toluene, trichloroethylene, trichlorophenol, and formaldehydes; metals like lead and cadmium; and minerals such as asbestos and crystalline silica. All of those are known human carcinogens.
https://nwlaborpress.org/2014/04/firefighters-fighting-cancer-as-well-as-flames/
Sure thing, but you’ll have to crank up your GC-MS to use Bitcoin levels of electricity. ??????
Hmm! I wonder what kind of nasties were produced in the three week fire at the local landfill back in February 2015? The whole City of Kingston was blanketed with acrid smoke for the duration of the fire.
I’m of the view that something in that smoke affected me since, my vitamin C tolerance skyrocketed at about the same time as the fire and stayed very high (>24,000 mg) until early this last November. I had no discernible symptoms of any sort of infection outside of the usual cold/flu viruses for the whole 20 months but, my tolerance (requirement) for vitamin c remained stubbornly high the whole time. Unfortunately I don’t know of any medical researchers who are even remotely interested in pursuing why this would be the case.
For anyone who’s wondering what I’m prattling on about with this vitamin C stuff, look up “vitamin c bowel tolerance”.
Have your blood or urine checked for metals.
Doug – easy to analyse – not so easy to predict, and probably highly dependent on the exact conditions during the fire, even for the same nominal fuel mixture.
Al the spiders are on Vancouver Island. That reminds me, I have to clean my pump controls in the pumphouse….covered in spider shit. 🙂
All the spiders are on Vancouver Island.
You are not all that far from the truth! I have to admit I didn’t know you guys even have native tarantulas, well, “tarantuloids” but still pretty impressive!
https://bcmag.ca/spider-species-you-can-find-in-british-columbia/
Walk anywhere in British Columbia and you’ll be less than a metre from a spider. With more than 700 known species in the province, arachnids are everywhere, from mountaintops to intertidal zones. These eight-leggers are endlessly diverse and surprising—from the jumping spiders that dance to impress prospective mates, to the wily crab spiders that disguise themselves as flowers. Here is an introduction to 10 B.C. spiders—some common, some rare—with insights from the researchers who study them.
In the fall, wolf spiders begin to invade our house. They have a habit of climbing into sinks and tubs and not being able to get out. I have no idea how they squeeze in under the weather stripping. Maybe they come in small and grow, just getting to size by Sept.? I usually catch them in a glass and release them outside. I have a combo pub and shop that has to be regularly vacuumed to get rid of the daddy long legs. They’ll take over. Pretty good insect killers, though. And the crawl space (all crawl spaces) can be pretty scary with widows and recluses. They don’t even move, but they look poisonous and deadly. I just stay away from them.
My wife spent a coupe of years in Australia. Now, her stories are scary. You never put a glove or shoe on before shaking it out. Plus, never pick up wood or rocks without a good shakefirst. If a spider doesn’t get you a snake just might.
My wife spent a coupe of years in Australia. Now, her stories are scary. You never put a glove or shoe on before shaking it out. Plus, never pick up wood or rocks without a good shakefirst. If a spider doesn’t get you a snake just might.
Yep! I survived camping in the wilds of Brazil by applying the same practices. It becomes pretty much second nature. I also made a point of never killing any of these creatures unnecessarily. The more you understand them the less scary they become. Live and let live!
U.S. Global Leadership,
$180BN INVESTMENT IN PLASTIC FACTORIES FEEDS GLOBAL PACKAGING BINGE
Colossal funding in manufacturing plants by fossil fuel companies will increase plastic production by 40%, risking permanent pollution of the earth. The global plastic binge which is already causing widespread damage to oceans, habitats and food chains, is set to increase dramatically over the next 10 years after multi-billion dollar investments in a new generation of plastics plants in the US. Fossil fuel companies are among those who have ploughed more than $180bn since 2010 into new “cracking” facilities that will produce the raw material for everyday plastics from packaging to bottles, trays and cartons.
“We are already producing more disposable plastic than we can deal with, more in the last decade than in the entire twentieth century, and millions of tonnes of it are ending up in our oceans.”
https://www.theguardian.com/environment/2017/dec/26/180bn-investment-in-plastic-factories-feeds-global-packaging-binge
With more than 80 million people a year adding to the planet and more people being able to afford packaged items, the industry is merely feeding the growing demand. It staggering to think that a new US population is added to the world every four years. That’s a lot of new plastic and everything else demand.
We better find ways to use the waste, looks like the plastics industry is locked in for a while.
Houses and buildings from waste plastic.
https://www.forbes.com/sites/lauriewinkless/2016/07/21/these-houses-are-built-with-blocks-made-from-waste-plastic/#39aec4f17894
Yup — More than 4.8 million metric tons—that’s about how much plastic waste gets dumped into the world’s oceans from land each year. And this number is just a conservative estimate. Researchers believe the real amount could be as high as 12.7 million metric tons.
Almost three weeks ago, I posted a picture of the main, east to west storm drain in the city where I live. Below is a the original picture with another from about a week later to the right. Sharp eyed readers will notice a discernible increase in the amount of trash in the gully in the image to the right, including the carcass of an old fridge. I took a picture looking straight down from the bridge into a pile of garbage that included an old door, an desktop computer chassis, the pedestal of a fan, wire frame shrouds from a fan, polystyrene cups (ramen noodles), polystyrene food containers (“lunch boxes”), plastic bottles, plastic bags, metal scraps and scraps of wood.
In the earlier post including the first picture, I had mentioned that a passenger in my vehicle, on having the garbage in the gully pointed out to them, had obviously never given a moments thought to where all the trash would eventually end up. I would guess that the person or persons who discarded an old fridge in the gully, along with all the people who dump their household waste in the gully, have never given such matters a moments thought either. Into the gully, out of sight (unless you happen to look into the gully), out of mind!
I share the despair voiced by others in this forum when I think of all the people with whom we share this planet that don’t give a moments thought to such matters. I wish I could force them to consider these matters before they become an unmanageable menace but, I feel quite hopeless in that regard.
I guess I will just have to just continue to focus on showing how one might reduce ones carbon footprint and “stick it to the man” in the process (solar PV and EVs).
Interesting, here anything metallic in that trash would have been scavenged out in no time. Pepineros would have noted this as a regular dumping ground and made regular sweeps for bounty. Why does this not seem to happen there?
NAOM
Stereoscopic pollution drawing:
“We are already producing more disposable plastic than we can deal with, more in the last decade than in the entire twentieth century, and millions of tonnes of it are ending up in our oceans.”
Petroleum based polymers are a huge waste problem but if you look at the numbers of natural polymers that nature regularly deals with. Compared to those numbers which all number in the multiple billions of tons. Plastics barely show up at about 300 million tons yet are killing everything! We do not need any petroleum based plastics if we switch to natural polymers! We now have the knowledge and the technology to seriously rethink the materials palettes we use in our industries.
There is a reason I have posted this particular link a few times already.
https://www.youtube.com/watch?v=_wHT-FsCJjM
The Biggest Revolution in 3D Printing is Yet to Come
.
CHARCOAL REMAINS COULD ACCELERATE CO2 EMISSIONS AFTER FOREST FIRES
“Charcoal remains after a forest fire help decompose fine roots in the soil, potentially accelerating CO2 emissions in boreal forests.”
https://www.sciencedaily.com/releases/2017/12/171228100916.htm
Sounds like more study is needed on this one.
ENTERTAINMENT
Bad Lip Reading’s Trump Christmas Tune Has Melania Saying ‘Help Me’
The creepy jingle features both the real and an animatronic Trump “singing” about Christmas.
https://www.huffingtonpost.com/entry/bad-lip-reading-trump-christmas_us_5a452404e4b06d1621b78043?ncid=inblnkushpmg00000009
A couple of new start-up companies have figured out how to make something that looks and tastes like ground beef, but is made from plants.
http://beyondmeat.com/
https://www.impossiblefoods.com/burger/
What they found is the key missing ingredient is heme, an iron-containing compound that forms the non-protein part of hemoglobin. Plants only make a tiny amount of heme in the roots, but this would be way to expensive so they use genetically modified yeast to make it in large quantities. The heme is harvested as a yeast extract which looks a lot like blood. They add that to what is basically a falafel and now it tastes just like beef.
I’m not sure about all of this, but it might be a great help. It kind of grosses me out a little, the raw meat is dripping with that heme. I’m not sure I’m comfortable eating it every day, but I’m not sure why.
They sell beyond burgers in the local grocery stores here, I may give it a try. It’s kind of expensive ($11/lb) for the beyond patties, less for some of the other products. The manufacturing plant is doing a huge expansion. The cost should come down as they expand.
Interesting to note the structural similarities between Heme molecules and chlorophyll.
.
I noticed Beyond claims “no GMO” and that the red color comes from beets. But the ingredient list has “yeast extract” pretty high up on the list. So okay, they only use the extract from the GMO yeast, I guess that still counts as being a non-gmo food? Maybe, but sounds like a lawsuit waiting to happen. The impossible burger is getting higher ratings on taste but is only available at a few restaurants right now, but they are up front about the heme.
I’ve got some of the beyond burgers to try tonight.
Sorry, found this press release and to update – heme is only used in the imposible burger not the beyond.
http://beyondmeat.com/whats-new/view/beyond-the-headlines-a-clarification-regarding-beyond-meat-and-impossible-foods-
“A New York Times article came out last week about Impossible Foods. The piece raises questions about heme, the GMO-derived ingredient in their Impossible Burger.
We’ve received a number of questions from our Beyond Meat consumers about heme,which, we do not use. “
So think of it this way, Insulin is produced commercially by GMO yeast. But someone who needs insulin doesn’t inject the yeast into their blood they only inject the insulin. The insulin is still just insulin otherwise it wouldn’t work!
Same with the heme protein molecule, it may be produced by GMO yeast but you aren’t using that yeast to produce frozen vanilla yogurt which you then consume GMO yeast and all. You are only extracting and then consuming the heme by itself. Ok, you are adding the heme to all the other ingredients that make up the burger.
BTW this whole fear of GMOs is total bollocks! All living organisms haven been GMOed by nature over the course of billions of years of evolution. If someone doesn’t like it, they can just starve themselves.
GMO as a technology isn’t necessarily bad, it all depends on what the modifications do. BUT, in food we are mostly tailing about herbicide tolerance or build in pesticides. The corn may be roundup ready – but humans are not. Now that roundup resistance is common in many weeds they are working on other more potent herbicides, like those used in agent orange. Roundup can be detected most days in the air in Chicago, it’s everywhere now – that’s bad enough, but imagine that being replaced with agent orange.
Yes, Monsanto is definitely not a human friendly corporation.
There are some grassroots organizations, no pun intended, that promote open source seeds to farmers the world over. If I find the link I will post it.
Wow, I just tried the beyond burger and it’s really good. Far better than any “veggie” burger I’ve ever tried. It even smells like beef when it’s cooking, there were a few odd odors when I flipped them, but it didn’t last long.
It is sometimes called the Porphyrin Ring. The big difference is not in the shape of the molecule but in the element in the center of the ring. Iron in animals and magnesium in plants. This molecule is what gives pigment to blood and green plants.
When the hemoglobin molecule ages, the liver pulls it out of the bloodstream, pulls the iron atom out, saves it, then dumps the rest of the molecule into the stomach to be expelled. The ring breaks and begins to slowly change color as it begins to change its shape. The Molecule then first turns green in the liver bile, then yellow then brown in the bowels. It follows the same color change in the bowel as it does in leaves. It is responsible for the pigment in shit.
Hey, I know my shit. 😉
LOL!
After chilly forecast, Trump tweets U.S. ‘could use a little bit of that good old Global Warming’
By Dino Grandoni December 28 at 9:03 PM
https://www.washingtonpost.com/news/energy-environment/wp/2017/12/28/after-chilly-forecast-trump-tweets-u-s-could-use-a-little-bit-of-that-good-old-global-warming/?utm_term=.ae95f311b3bc
Even though he is vacationing in Palm Beach, Fla., where temperatures are in the 70s, Trump tweeted on Thursday seemingly mocking those who accept climate science, suggesting that the East Coast will be so cold on New Year’s Eve that global warming may be a good thing instead of an environmental calamity.
Donald J. Trump ✔
@realDonaldTrump
In the East, it could be the COLDEST New Year’s Eve on record. Perhaps we could use a little bit of that good old Global Warming that our Country, but not other countries, was going to pay TRILLIONS OF DOLLARS to protect against. Bundle up!
6:01 PM – Dec 28, 2017
118,486 likes
125K people are talking about this
Before sending that message, Trump had not sent any tweet containing the phrase “climate change” or “global warming” since becoming president, according to the Trump Twitter archive.
Meanwhile, 13 scientific studies suggest ‘Little Ice Age’ looming
Published: 5 hours ago Bob Unruh
http://www.wnd.com/2017/12/13-scientific-studies-suggest-little-ice-age-looming/
Global-warming diehards who converted their cause to “climate change” when the warming ceased a few years back are being dealt another blow as scientific forecasts of global cooling are about to take over.
“During 2017, 120 papers linking historical and modern climate change to variations in solar activity and its modulators (clouds, cosmic rays) have been published in scientific journals,” reported Kenneth Richard at NoTricksZone.
Richard compiled a list of multiple studies from the past few years drawing the same conclusion: It’s the sun’s activities that have a huge influence on whether earth’s temperatures vary. Thirteen forecast global cooling.
The global-warming alarmists contend mankind’s use of fossil fuels is irreparably heating up the earth’s average temperatures.
Global warming has become an industry, with the buying and selling of “carbon credits” that grant permission to use carbon fuel, massive tax plans to pay for alternative energy programs and more.
Richard explained: “It has been increasingly established that low solar activity (few sunspots) and increased cloud cover (as modulated by cosmic rays) are highly associated with a cooling climate. In recent years, the earth has unfortunately left a period of very high solar activity, the Modern Grand Maximum. Periods of high solar activity correspond to multi-decadal- to centennial-scale warming.”
He said solar scientists are now increasingly forecasting a period of very low activity that will commence in the next few years, by around 2020 to 2025. The result? Cooling.
“This will lead to climate cooling, even Little Ice Age conditions.”
Meanwhile, 13 scientific studies suggest ‘Little Ice Age’ looming
Published: 5 hours ago Bob Unruh
Aside from 13 being an unlucky number, they suggest nothing of the sort!
Case in point, the first paper in your list by: Sun et al, ( admittedly I did get a bit of a chuckle from the lead author’s name…) mentions climate change only to say that:
“This finding is theoretically valuable for studying solar activity and global climate change.”
That is a long long ways away from saying we are entering a period of global cooling.
If anything, given that we should supposedly be entering a period of global cooling and things on the ground are actually warming, it would imply that we have a much greater problem than previously believed.
Now please get back under whichever bridge you crawled out from!
The evidence is really piling up now.
Which evidence? Or evidence for what?
That Bob’s a troll.
Arctic ice extent has started setting new daily record lows (breaking last year’s records). This year the Chukchi Sea has been slow to freeze, maybe as the water has been warmed in previous ice free summers coupled with prolonged warmer air temperatures there (the cold air has been pushed south over the USA this week). Plus there has been more ice transport through the Nares Strait than previously as the thick ice that used to block it got smashed to pieces last summer.
Global sea ice extent and area are dropping fast as well and might start break 2016 records before the new year.
Record low Arctic sea ice for date, December 27.
Numbers:
https://ads.nipr.ac.jp/vishop.ver1/data/graph/plot_extent_n_v2.csv
Visual:
https://s3-us-west-1.amazonaws.com/www.moyhu.org/blog/polview.html
Five days running for record low Arctic sea ice.
POTUS wants some Global Warming
Perhaps we could use a little bit of that good old Global Warming that our Country, but not other countries, was going to pay TRILLIONS OF DOLLARS to protect against.
Really now?! What a lying POS scumbag this guy is!
https://www.factcheck.org/2017/05/trump-paris-agreement/
Trump made two claims about the Paris Agreement, a global accord aimed at addressing climate change, that require context:
Trump said that the U.S. “pays billions of dollars” for the Paris Agreement, but China, Russia and India have paid “nothing.” The U.S. has pledged $3 billion, but so far has paid $1 billion. The agreement requires developed countries, such as the U.S., to help developing countries, including China and India, with mitigating climate change. Russia has not ratified the agreement.
He said that “the agreement could ultimately shrink America’s GDP by $2.5 trillion over a 10-year period.” But that estimate is over 20 years, not 10, and it comes from a conservative think tank. Another analysis described the potential economic impact as “modest” and the cost of delaying action as “high.”
Trump made his claims at a rally in Harrisburg, Pennsylvania, on his 100th day in office, April 29.
Well, just this past year we had some pretty devastating storms that cost quite a bundle and I’ll bet the extreme winter weather wreaking havoc through out the country won’t be cheap either.
https://insideclimatenews.org/news/11092017/hurricanes-irma-harvey-damages-cost-climate-change-global-warming-government-warnings
With relief operations after Harvey’s record-smashing floods just getting under way in Texas, and Irma, the most powerful Atlantic storm ever witnessed, still howling through Florida on Monday, it’s too early to say just how much these two storms will cost taxpayers.
On Friday, President Donald Trump signed a bill that provides $15 billion in immediate hurricane relief—an amount that clearly will not cover the damage but was intended to stop the agencies from running out of cash in just a few days.
To put that in perspective: 15 billion is 5 times the amount originally pledeged by the US when it signed the Paris Agreement.and 15 times what the US has actually paid so far. That’s just the emergency funding for two storms. BTW, that didn’t include Maria’s costs when it hit that foreign country, Puerto Rico…
The Estimates: How Much Will This Cost?
Early estimates of the combined damage from the pair of record-breaking storms could reach $290 billion—nearly a quarter of the total costs of all natural disasters in the United States from 1980 to this year. That doesn’t account for the wildfires and extreme heat burning up the American West, or the nine major disasters—including drought and floods—that hit the country from January to July.
BTW early estimates from Maria in Puerto Rico alone would add another 100 billion to to the 290 billion. So the US is looking at almost 400 billion to clean up from just this summer’s Hurricane season alone. And the Moron in Chief and his administration think 3 billion is too much?!
He thinks it’s better to pay 10’s of trillions on fossil fuels and get all that free pollution. What a bargain hunter.
POTUS is a waste of rations
I’m detecting liberal jealousy over all of Trump’s accomplishments during his first year in office.
Adam, you forgot to put a smiley face after your reply. You need to do that when you are being totally ridiculous. Else someone might think you are serious. God what an embarrassment that would be. That is having people think Trump had actually accomplished something good during his first year in office. All his accomplishments were just god awful terrible.
Really, Adam, you don’t want people thinking you are some kind of ignorant right-wing nutcase do you? So next time you are being sarcastic, remember your smiley face. 😉
all of Trump’s accomplishes…
Let me guess? You don’t spend a lot of time outside the US do you?
Yeah, Trump has a long list of ‘accomplishes’, all right!
If nothing else, he did manage to bring the US from being a respected leader of the free world to being the number one laughingstock among almost all world leaders regardless of their being conservative, liberal or authoritarian. Everyone pretty much thinks he is a joke!
Trump pushes past Montenegro’s PM –
https://www.youtube.com/watch?v=86yuWWhibFA
Well here are 95 things Trump has accomplished or succeeded at in his first year in office. C’mon, you guys can’t find even ONE thing on this list you are happy about?
1. Nominated Supreme Court Judge Gorsuch
2. 59 missiles dropped in Syria
3. He took us out of TPP
4. Illegal immigration is now down 70% (the lowest in 17 years)
5. Consumer confidence highest since 2000 at index 125.6
6. Mortgage applications for new homes rise to a 7 year high
7. Arranged 20% tariff on soft lumber from Canada
8. Bids for border wall are well underway
9. Pulled out of the lopsided Paris accord
10. Keystone pipeline approved
11. NATO allies boosted spending by 4.3%
12. Allowing VA to terminate bad employees
13. Allowing private healthcare choices for veterans
14. More than 600,000 jobs created
15. Median household income at a 7 year high
16. The stock market is at the highest ever in its history
17. China agreed to American import of beef
18. $89 billion saved in regulation rollbacks
19. Rollback of a regulation to boost coal mining
20. MOAB for ISIS
21. Travel ban reinstated
22. Executive order for religious freedom
23. Jump started NASA
24. $600 million cut from UN peacekeeping budget
25. Targeting of MS13 gangs
26. Deporting violent illegal immigrants
27. Signed 41 bills to date
28. Created a commission on child trafficking
29. Created a commission on voter fraud
30. Created a commission for opioids addiction
31. Giving power to states to drug test unemployment recipients
32. Unemployment lowest since may 2007
33. Historic Black College University initiative
34. Women In Entrepreneurship Act
35. Created an office or illegal immigrant crime victims.
36. Reversed Dodd-Frank
37. Repealed DOT ruling which would have taken power away from local governments for infrastructure planning
38. Order to stop crime against law enforcement
39. End of DAPA program
40. Stopped companies from moving out of America
41. Promoted businesses to create American jobs
42. Encouraged country to once again buy American and hire American
43. Cutting regulations two for every one created
44. Review of all trade agreements to make sure they are America first
45. Apprentice program
46. Highest manufacturing surge in 3 years
47 $78 Billion promised reinvestment from major businesses like Exxon, Bayer, Apple, SoftBank, Toyota…
48. Denied FBI a new building
49. $700 million saved with F-35 renegotiation
50. Saves $22 million by reducing white house payroll
51. Dept of treasury reports a $182 billion surplus for April 2017 (2nd largest in history)
52. Negotiated the release of 6 US humanitarian workers held captive in Egypt
53. Gas prices lowest in more than 12 years
54. Signed An Executive Order To Promote Energy Independence And Economic Growth
55. Has already accomplished more to stop government interference into people’s lives than any President in the history of America
56. President Trump has worked with Congress to pass more legislation in his first 100 days than any President since Truman
57. Has given the head executive of each branch 6-month time frame dated March 15, 2017, restructured and improved the efficacy of their branch
58. Signed executive order on the Establishment of Office of Trade and Manufacturing Policy
59. Signed an executive order aimed at expanding offshore drilling
60. Signed a memo directing an investigation into aluminum imports, and an order aimed at cleaning up Veterans Affairs
61. Signed two executive orders, including one directing a review of national monument designations under prior administrations
62. Signed an executive order intended to boost the agriculture industry, and participated in a farmers’ roundtable
63. Signed proclamation on Holocaust Remembrance
64. Signed financial services executive orders at the Treasury Dept
65. Signed a memo ordering a probe into whether foreign steel is hurting U.S. national security
66. Signed the Veterans Choice Program Extension and Improvement Act
67. Signed the Buy American Hire American executive order
68. Signed bill allowing states to block Planned Parenthood funding
69. Signed two executive orders on trade aimed at reducing the trade deficit
70. Signed an executive order establishing a commission on drug and opioid abuse
71. Signed an executive order on energy independence at EPA headquarters
72. Signs bill rolling back regulations via the Congressional Review Act
73. Signed a bill on space exploration
74. Signed an order directing a top-to-bottom audit of the Executive Branch
75. Signed revised executive order suspending the U.S. refugee program and entry for travelers from six mostly Muslim countries
76. Signed an order calling for a review of the “waters of the United States” environmental regulation, and another order moving the HBCU (Historically Black College and Universities) offices back from the Education Department to the White House
77. Signed two resolutions, one encouraging women at NASA and another promoting women in entrepreneurship
78. Signed bill nixing a Social Security Administration rule regarding gun background checks
79. Signed an executive order directing every agency to set up a task force to eliminate red tape
80. Signed legislation undoing coal mining regulation
81. Signed legislation rolling back part of the Dodd-Frank financial regulations. The legislation repeals a rule that requires oil and gas companies to disclose payments to the U.S. or foreign governments for commercial development
82. Signed three orders creating DOJ task forces to combat crime and cartels
83. Issued an executive order directing the Treasury secretary to review the 2010 Dodd-Frank financial regulatory law
84. Issued a presidential memorandum instructing the Labor Department to delay implementing an Obama rule requiring financial professionals who are giving advice on retirement, and who charge commissions, to put their clients first
85. Signed executive order instructing agencies that whenever they introduce a regulation, they must first abolish two others.
86. Signed executive orders to restructure the National Security Council and Homeland Security Council and to extend bans on ex-administration officials working as lobbyists to five years — including a lifetime ban on ex-officials lobbying for foreign countries.
87. Signed memorandum on fighting ISIS
88. Signed an executive order imposing a 120-day suspension of the refugee program and a 90-day ban on travel to the U.S. from citizens of seven terror hot spots, including Iraq, Iran, Syria, Libya, Yemen, Somalia, and Sudan
89. Signed orders dealing with immigration enforcement and border security. Measures called for constructing a U.S.-Mexico border wall, cutting funding to sanctuary cities, hiring thousands more border and immigration agents, toughening immigration enforcement and reinstating federal-local immigration partnerships
90. Signed orders reviving consideration of the Keystone XL and Dakota Access pipelines, as well as additional actions aimed at expediting the permitting process and encouraging the use of U.S. steel
91. Signed orders withdrawing the U.S. from the TPP trade deal; imposing a federal hiring freeze; and reinstating the ban on federal funding for abortion services in other countries
92. Signs order telling agencies to ease the burden of ObamaCare
93. Signed legislation allowing retired Gen. James Mattis to serve as Defense secretary
94. Passes Kate’s Law
95. Passes No Sanctuary for Criminals Act
C’mon, you guys can’t find even ONE thing on this list you are happy about?
That’s a rhetorical question right?
Most of the things on that list are either antithetical to basic universal human rights, regressive, unnecessary because there are better ways to achieve those things or because there were already laws in place to achieve them or they are just pure unadulterated bullshit.
Sounds like a list any 1930s ultra nationalist, xenophobic pseudo patriotic, fundamentalist, superstitious dog fearing, anti reason, racist, misogynistic, alt-right wing, authoritarian minded fascist or Nazi would probably find appealing. I have a much higher standard in mind for the US and the rest of the planet in the mid 21st century, we are not going back to the 1930s…
This is an example of what happens to people who think that the items on that list are in any way shape or form positive, They are eventually sentenced to prison for war crimes! This guy got off easy by committing suicide!
https://www.youtube.com/watch?v=yFuR17YDpVk
War Criminal Dies After Drinking ‘Poison’ In Court After Judge Confirmed 20-Year Sentence | TIME
Oh, never mind, my bad, you just forgot the /SARC tag and the smiley face.
“87. Signed memorandum on fighting ISIS”
Wow. So bold. And brilliant.
Hey, isn’t he also a man who bragged about sexual assault.
I guess that is ok in the bible belt.
Signing a memo is considered doing something new I guess. In reality Syria, Iran and Russia are doing the heavy lifting in riding this world of ISIS. But hey, Trump signed a memo.
96. Dresses himself and ties his own shoes in the morning.
“Bannon joked to a friend last month that the president is like an 11-year-old child”
http://thehill.com/blogs/blog-briefing-room/news/366062-bannon-called-trump-an-11-year-old-child-report
I’ll admit I’m happy about #19:
19. Rollback of a regulation to boost coal mining
The last thing we need right now is a regulation to boost coal mining.
MAGA!
(Make America Grammatical Again)
Late stage capitalism was never going to be fun.
Donald is just doing his role, no matter how infantile or minor.
He is what we have at this gesture.
My wife and I won’t even cross the border anymore to visit relatives (sister). My brother won’t either. They can come see us in Canada.
Apparently this attitude is shared.
“Canadians are making fewer trips to the United States, and foreign appetite for travel in Canada has hit its highest May on record.
Statistics Canada reported Thursday that Canadians made 3.2 million trips to the United States in May, down almost eight per cent from April’s level and nearly six per cent lower than the same month a year ago.”
Yep,
Canada is going to build a wall and will gladly pay for it! 🙂
…And marvel at the floating portion of it…
7 Reasons Why We Should Have Open Borders
Hi Caelan,
Does Canada have open borders?
“Climate scientist Sarah Myhre aptly described the tweet as “Phenomenally dumb,” for several obvious reasons. ”
2017 was the hottest year on record without an El Niño, thanks to global warming
https://www.theguardian.com/environment/climate-consensus-97-per-cent/2018/jan/02/2017-was-the-hottest-year-on-record-without-an-el-nino-thanks-to-global-warming%5Dtheguardian.com
Dutch plan to build a giant windfarm in the North Sea with a new island to act as it’s energy hub.
The power hub would send electricity over a long-distance cable to the UK and Netherlands, and possibly later to Belgium, Germany, and Denmark.
TenneT, the project’s backer and Dutch equivalent of the UK’s National Grid, recently shared early findings of a study that said its plan could be billions of euros cheaper than conventional windfarms and international power cables.
https://www.theguardian.com/environment/2017/dec/29/is-this-the-future-dutch-plan-vast-windfarm-island-in-north-sea
At least the world is getting a new look. I hope they have the blades high enough off the water to handle rogue wave height.
The windfarm is not the selling point, the turbines will be built anyway, the (actually not so) new addition is the large artifical island which would be a hub for HVDC transmission lines betwen the UK, central Europe and Scandinavia and would also host other infrastructure for the construction and maintenance of wind farms.
For the car world it was the Prius. For the passenger aircraft world it’s the E-Fan.
However, last month a consortium comprising Airbus, Rolls-Royce and Siemens said they had found a way to use hybrid electric jet engines to conquer gravity. They are converting a regional jet into a demonstration plane, called the E-Fan X, which will be ready by 2020.
Paul Stein, chief technology officer at Rolls-Royce, said: “It is a two-tonne battery pack – the batteries are still fairly heavy. Beating gravity into submission is a huge challenge, so weight is a big issue.”
https://www.theguardian.com/business/2017/dec/28/electric-passenger-jet-revolution-looms-e-fan-x-air-taxis-hybrid-planes
Beat harder: Nature will pretend to submit, for awhile…
At least the world is getting a new look. I hope they have the blades high enough off the water to handle rogue wave height.
While the Dutch have a pretty good record of keeping the sea and waves at bay, no pun intended, I do kinda like what the Brits or more precisely the Scotts, are doing on the isle of Orkney.
Orkney 3. EMEC Tidal Power | Fully Charged
https://www.youtube.com/watch?v=YEQQl-qpkCc
Very nice, thanks.
Wind, solar, tidal, wave, geothermal, all sources of essentially infinite clean energy. Wonder if the tidal energy systems can be mostly made from waste plastic. Would solve the corrosion problems.
How about turbine blades 3D printed from layered chitin and CaCo3 to have properties similar to high tensile ceramics based on how abalone make their shells at the nano scale structure. Never yet heard of an Abalone shell that had a corrosion problem in salt water. 😉
Sounds good too, I was just trying to take care of two problems at once. The alternative materials industry will eventually displace many plastics.
I hope you mean Carbon and Oxygen not Cobalt 😉
Yeah, CaCO3
Actually Ca2CoO3 has some interesting properties too 😉
Calcium Cobalt Oxide (CCO) is a p-type semiconductor obtained by heating calcium carbonate (CaCO3) and cobalt oxide (Co3O4) to form a misfit-layered crystalline structure with composition [(Ca2CoO3)(CoO2)]1.61. CCO thin films have outstanding thermoelectric properties including high thermal stability…
Interesting.
Unsure about that, but maybe that’s sarcasm?
Sounds like one of the myths we tell ourselves (as if these environmental energies are going to somehow defuse out of the environment and into our laps without a thought)… Like, how are we using the energy, what do we need it for, do we actually need it, is it going to make our lives better in the final analyses, how does using said energy affect our environs and lives in general and so forth.
I am unsure we can get away with shallow/limited/mythic investigations of things like large-scale energy systems manufacture and usage/disusage… I don’t think nature’s allowing us and going to allow us in the future.
Maybe if we had more of our real names and locations, etc., some of us might not play so fast and loose with their ‘convictions’ on POB.
But waste plastic? Sure, Gonzo, anything’s possible in the reality of the mind. Right now, apparently, ‘waste plastic’ is coursing through our bloodstreams. At the moment, I am trying to dissolve it with alcohol whereby I can pee it out into the environment, like plutonium… What is it they say? The solution to pollution is dilution? Brilliant.
Unsure about that, but maybe that’s sarcasm?
Sounds like one of the myths we tell ourselves (as if these environmental energies are going to somehow defuse out of the environment and into our laps without a thought)… Like, how are we using the energy, what do we need it for, do we actually need it, is it going to make our lives better in the final analyses, how does using said energy affect our environs and lives in general and so forth.
You really just can’t help yourself can you?
Caelan MacIntyre aka Killian over at Real Climate keeps getting his ass handed to him for being a self centered arrogant Ahole, but he just doesn’t learn as this comment indicates. It is typical of the kind of response he gets everywhere he goes to preach his permaculture only solution to mankinds problems and his anti all technology, especially renewables mantra!
272
Kevin McKinney says:
26 Dec 2017 at 12:02 PM
#266, Killian–
I am not here to dialogue on simplicity: I am here to teach it. Do not try to teach sustainability to a regenerative systems designer: Listen.
And that is your problem, Killian, in a nutshell. I’ve been teaching since I was 19 years old, and the most important thing that those decades of experience has taught me is this: You cannot teach without dialog, for the simple reason that you cannot teach without meeting your students where they are, cognitively and emotionally; and you cannot know where they are without listening to them with respect.
Over and over you fail that test by treating those you aspire to teach with contempt. You imagine that you are completely enlightened, that you know The Truth, and that therefore you need not listen to anyone else. Simply asserting your Truth, in your mind, should always suffice because it is entirely factual, entirely correct, and is therefore always the perfect answer.
For example:
Dismissiveness is to not fully consider, to hand-wave away. This is far closer to your behavior. I point out facts, you dismiss them. You state *opinions*, I tell you why they are incorrect*…
Well, no, it’s not always adequate to assert The Truth. Because even if your conceptual model were as completely correct as you think it is–which I very much doubt, for reasons that I’ve attempted to make clear over a span of years now–you are not understanding and responding to the realities that your interlocutors are living in. As a teacher, you need to build a bridge for your students to cross from their current reality to a wider and relatively more adequate one. You can’t build a bridge without understanding *both* sides of the chasm.
You say you want to teach. Evidence says you’re failing miserably, since commenter after commenter (including you yourself!) says that we’re failing to ‘get it.’ So prove that you mean what you say: Try doing something differently than which has been failing so abjectly to achieve your ends.
Yes, Caelan as Kevin, and just about everyone over at Real Climate says to you, try doing something differently, like getting off your high horse and maybe exhibiting some humility. You don’t have any more of the answers to the predicaments facing all of us. than anyone else.
Caelan- come back when you’ve grown a potato, killed the chicken you eat, turned your compost pile, split your wood, and done some real stuff in your life.
Hickory, your comment here, perhaps like many others of yours, seems quite indicative of the kind of bilge alluded to in my reply to Fred.
(I used the adjective, ‘bilge’, in part because I seem to recall Euan Mearns using it on his site to describe a comment or two from someone with the name of Hickory. Anyone we know?)
If you want to sidestep the issue of someone’s comment and, instead, conduct an ad hominem, or make a personal criticism, at least get the names and people and what they are doing and have done, right. If you can.
Make it your new year’s resolution.
BTW, wild cattail apparently has more edible starch per acre than potatoes and they grow themselves. I’ve eaten it.
How about you? Do you want to compare notes or just pussy around behind your screen?
There’s more to life and a life than uncritically masturbating to the fruits of the crony-capitalist plutarchy.
Peak Oil Bible
‘Caelans’ ‘lurking’ everywhere LOL…
And thank you, too, for an example of how people ostensibly like to create fantasies and myths, often based on their own errors (self-reinforcing feedbacks?), to help them psychologically manage the persistent and confounding intrusions of reality that lurk all around them.
So let these Kevins and/or Killians and/or whoever, be Caelan and it will be so, simply because we believe it to be.
Amen
Imagine this new idea, making windmills out of wood!
https://newatlas.com/timbertower-wooden-wind-turbine/25007/
They figured out how to grow magnetic trees? Awesome 😉
I do like dodecahedral…
The generating parts are made from the copper beech and ironwood. 🙂
Spit one out on the 3D Printer..
Hi Sweethearts…
I am posting this after my first drink brew called ‘Exile On North Street’ (the draft version) from Unfiltered Brewing, Halifax, to say that my as-mentioned first home cider attempt failed…
It appears that it was a problem with the apple and its peel that was used to introduce the wild yeast. I left it on the counter for too long maybe, and also the apple, itself, was probably lying around at the farmers’ market vendor kiosk for awhile too, so that other ‘pathogens’ were introduced before the yeast could get a foothold.
So, my second attempt (2010-12-28) is a ‘cheat’ with a commercial ‘champagne’ yeast (apparently good for ciders) bought at the local wine-making shop, Noble Grape. I’ll wait until next autumn when I can get an apple off of a tree reasonably away from traffic and to bypass any potential issues with store-bought organic apple yeast.
Now I am having ‘Hopped Up’ cider from the other microbrewery down the road, The Chain Yard. I prefer cider– generally cleaner and crisper (not to be confused with CRISPR).
A feature or a bug?
2017 is a record-breaker for climate disasters – “The Trump administration has spent its 2017 dismantling federal actions designed to both address the root causes of climate change and to prepare for its impacts”
http://www.desdemonadespair.net/2017/12/2017-is-record-breaker-for-climate.html
Pollution (including ‘social pollution’) at this scale and form (likely) means death to government at this scale and form– a feature and a bug I guess, depending on who you talk to, and which features and bugs you’re talking about.
Sick society ≈ sick environment
The Golden Rule of Technological Progress: Innovation Doesn’t Solve Problems, It Creates Them
Sick society + its technology ≈ sick environment
Math rules. ‘u^
Revealing the Naked Emperor: Prof Kevin Anderson (November 2017)
A realistic look at how we are dealing with climate change and how, at the government level, we actually intend handling CO2 emissions.
“We are where we are now because we have chosen to fail.”
https://www.youtube.com/watch?v=Chsas3u8k-k
So how are we doing? After 50 years of warnings and lots of world meetings, are we actually reducing our fossil fuel burn and CO2 input to the atmosphere?
Increasing fossil fuel burn reported and underreporting of coal burning show that we are putting increasing amounts of CO2 into the atmosphere. Even the most optimistic views could only show a leveling off of our increases.
The steadily increasing rate of growth of atmosphericCO2 is a telling and disturbing fact. The decarbonization of the world is taking a long time and is actually only taking the icing off of a growing cake.
It looks like the world is fossil fuels plus renewables. We are minus 20 years now from when we needed to get really serious about this and as in my previous post, the models are depending upon mythical things that have not been successfully invented yet. So it’s worse than advertised.
Fossil Fuel Use is Rising Like There is NO Tomorrow
https://www.youtube.com/watch?v=75t4uTv9dts
I see your: Revealing the Naked Emperor: Prof Kevin Anderson (November 2017)
and your: Fossil Fuel Use is Rising Like There is NO Tomorrow
And I raise you a : Guy at McMaster University, Canada Nov. 7, 2017
https://www.youtube.com/watch?v=ZDZ-SBnyxKY
It had been quite a while since I’d seen one of his cheerful optimistic presentations…
Happy New Year Everyone!
Looking good: Mauna Loa Observatory Daily CO2
December 28, 2017: 408.28 ppm; December 28, 2016: 404.48 ppm
Meanwhile,
“U.S. crude oil production in October rose to the highest in more than 46 years and the production is expected to continue rising in 2018 to past historical level recorded in 1971 which will have significant effects on global energy balance”
Whoopee!
And, don’t forget, January sales are just around the corner and with that $180bn investment in new plastic factories feeding global packaging binge you can be assured your new toys have never been touched by human hands.
Hello Doug, those are indeed some interesting figures, but we ought to be putting them into a proper context within the entire dynamical Earth system. For example, Earth’s atmosphere is composed of about 78% Nitrogen and 21% Oxygen by volume. No other gas constitutes more than 1%. As a matter of fact, CO2 is actually a trace gas representing approximately 0.04% of the volume of dry air in the atmosphere. Below is an informative graphic which shows an accurate representation of the relationship of Mauna Loa CO2 measurements to the globe as a whole.
LT is always good for a laugh.
Yeah, a few grams of ricin shouldn’t do you any harm on your eggs at breakfast, why do they say 1.78 milligrams will kill an average adult? Happy New Year Louis.
… a few grams of ricin shouldn’t do you any harm on your eggs at breakfast…
True! Though it might be overkill by lunch time. 😉
The graph says “3.4% of CO2 is caused by human activity.” Then how do you explain the chart below?
does that mimic the exponential population growth rate as posted by GoneFishing ?
OMG its all those people breathing! *
Forbin
* perhaps other things **
** if we don’t burn it and China and India does , does it make any difference?
3.4% of CO2 is caused by human activity.
Nope! About 50% of the 404 ppm of CO2 currently in the atmosphere was added by humans since the beginning of the Industrial Revolution. And almost 60% of that total additional CO2 has been added since about 1960.
Rough back of the envelope calculation based on the graph Ron posted previously.
.
LT got that image from this anti science/anti-semitic web site.
https://globalfreezingyourassoff.wordpress.com/2015/02/12/carbon-dioxide-is-not-the-primary-greenhouse-gas/
The dudes a fucking moron.
LT – I wouldn’t have thought it possible, but you actually looked less dumb when you were rote copying the wiki article every week. The other greenhouse gases are mostly water. Each greenhouse gas has different properties so they can’t be compared based on concentration only as you have chosen to do. Water vapour increases as a result of warming, therefore it is an inevitable, and in geological time almost immediate, consequence of the increase in CO2. Therefore it is not an independent parameter and cannot be separated from the CO2, as you have chosen to do, and it’s recent rise is therefore all due to human activity, like the other GHGs. It’s rise is in fact a positive feedback (a concept your previously favourite website might be able to help you with), one of many, most of which aren’t currently included in the models, but this one is one of the fastest and has a big impact and is included, though possibly without yet a full representation of how the consequential changes in clouds impact things (which is probably for the worse).
3,62%. Impressive. Must be for the year 4552 BC and the result of scientific experimenmts by Conan the Barbarian.
You win! Guy is way too good at finding feedbacks and resists ignoring things.
Happy New Year!
https://www.iso-ne.com/isoexpress/
Oil to Electricity has been 25% + for days. Curious – check my math.
1.7MWh = 1 BO. So lets swag 1BO (Light) generates .9 MWh in a thermal plant. – Average Load 17k Mw x .25 (% generated by Oil) = 4200Mw ~ 4.700 kilo Barrels/hr. = 3.4 million Barrels/month at now a ~5X Premium to NG contract price ??
How did we get into this mess? If you listen to exponential growth myth about population you missed the reality of what really brought us to 7 billion people on the planet. The growth rate has been nowhere near constant, as in an exponential, but has been increasing up until just lately. The doubling time got dramatically shorter with time.
Doubling time (yrs) Resulting population (millions)
44 ============== 7000
58=============== 3500
143==============1750
288===============875
816===============438
1760==============220
—-initial~1090 BC=====110
7 billion was reached in 2012 after a 44 year doubling time. Suddenly we are in a 200 year doubling time, having reached partial limits of death rate and reduced child mortality. This could change as developing countries reduce their death rate (through medicine and improved agriculture) and child mortality. It could also go the other way as we become involved in a logistic growth pattern due to depleting resources.
Reasonably accurate predictions of population are not possible in the face of advancing technology running up against decreasing energy and material availability, climate change, and other limits.
Well the median estimate for future growth sees the world population reaching 8.6 billion in 2030 and 9.8 billion in 2050 so with luck we’ll get to 10 billion at some point.
Just as the population growth was not just exponential but the rate of growth was also a variable due to advancing technology, knowledge and civilization, the rate of decay in a logistic function will also be a variable in a rapidly changing world where technology and knowledge are coming up against real natural limits.
Our whole system depends on insects and phytoplankton. We know the insects are dropping dead at a high rate, what do we know about phytoplankton?
We need food, oxygen and the natural carbon sequestration cycle. They are failing as we watch. We need to do everything we can to mitigate these problems, right now. We don’t need to see how fast we can rush at the cliff and not quite fall over, the slipping over the edge is already happening. The clawing and struggle to not fall over has not really happened. The brain is 98% disengaged and the adrenal glands have failed. The cake and eat it too era is long over and hardly anyone recognizes that.
Maybe 2018 will be the year where most people start to wake up and hear the screaming of our dying fellow species. We go, if they go. Isn’t that irony?
https://www.scientificamerican.com/article/phytoplankton-population/
https://phys.org/news/2015-09-oceanic-phytoplankton-declines-northern-hemisphere.html
Right now as we enter the bottleneck, best to down a bottle. Happy New Year.
Maybe 2018 will be the year where most people start to wake up and hear the screaming of our dying fellow species. We go, if they go. Isn’t that irony?
Trouble is they mostly aren’t screaming. They are just quietly blinking out, one by one like a string of faulty Christmas lights. The worst part is that some are going extinct before we even know of their existence and what supportive roles they play in the ever more fragile tapestry of life on our planet.
Maybe we are the ones who should be screaming bloody murder.
“Maybe 2018 will be the year where most people start to wake up and hear the screaming of our dying fellow species.”
Don’t hold your breath. According to the UN Environment Programme, the Earth is in the midst of a mass extinction of life. Scientists estimate that 150-200 species of plant, insect, bird and mammal become extinct EVERY 24 HOURS. This is nearly 1,000 times the “natural” or “background” rate and, say many biologists, is greater than anything the world has experienced since the vanishing of the dinosaurs nearly 65m years ago.
https://www.huffingtonpost.com/2010/08/17/un-environment-programme-_n_684562.html
All the more reason to start an emergency program to protect what is left and to immediately reduce our carbon footprint. There is no good reason to finish off the rest.
The UN frequently makes things up in order to suit its radical left wing ideology.
Ricky Moron, every word of that UN report is factual. We are in the midst of the sixth extinction. Only stupid right-wing idiots don’t believe it because it does not suit their very stupid right-wing ideology.
I think many people do not believe it because they rarely even go outside, let alone even care about the natural world. Seriously, I’ll bet the average North American spends less than 10 minutes outside per day.
Hell, I just looked it up:
“According to the Environmental Protection Agency (EPA), the average American spends 93% of their life indoors. 87% of their life is indoors, then another 6% of their life in automobiles. That’s only 7% of your entire life outdoors. That’s only only one half of one day per week outdoors Ouch.”
https://snowbrains.com/brain-post-much-time-average-american-spend-outdoors/
I used to fly floats (sea planes) on the BC Coast to make my living. I started in the late ’70s and ended my last part-time gig about 2005. My co-workers and I were commenting on the steady glacier reductions long before AGW was even mentioned. In fact, at that time people were talking about a new ice age.
With the pine beetle kills, forest fires, salmon migration changes and new warm-water species arriving I simply do not see how anyone can dismiss Man’s affect on the world. Temp and C02 records are pretty stark imo.
I don’t know what your talking about. This morning the golf course looked as good as it ever has.
The parking lot next to my local strip mall looked great too. They had just resurfaced the blacktop and painted bright new yellow lines to mark the parking spaces. I even saw a small flock of grackles fighting some seagulls over the chicken pieces in of a bag of KFC someone had dropped in one of the empty parking spots…
Oh yes, there is nothing that smells like progress as much as hot asphalt in the morning. But I can’t say we have your seagull problem here. After the financial crash of 2008, we have a racially integrated program of homeless that keeps our fast food parking lots clean.
Cheers !
But I can’t say we have your seagull problem here.
Maybe you can watch the David Attenborough Documentary… 😉
.
Maybe it’s just that our seagulls are a little smarter than us humans. You know it wasn’t them that elected Trump.
Unfortunately morons like Ricky can’t read or do math past a sixth grade level so they probably couldn’t comprehend any of the relevant scientific literature even if they tried to read it. The Universe could care less about ideology! The planet is not governed by politics and economic theories. The only things that really matter are natural laws. It’s basic physics, chemistry and biology all the way down. Has been for the last 4.5 billion years.
http://www.pnas.org/content/114/30/E6089.full
Biological annihilation via the ongoing sixth mass extinction signaled by vertebrate population losses and declines
Gerardo Ceballosa,1, Paul R. Ehrlichb,1, and Rodolfo Dirzob
Significance
The strong focus on species extinctions, a critical aspect of the contemporary pulse of biological extinction, leads to a common misimpression that Earth’s biota is not immediately threatened, just slowly entering an episode of major biodiversity loss. This view overlooks the current trends of population declines and extinctions. Using a sample of 27,600 terrestrial vertebrate species, and a more detailed analysis of 177 mammal species, we show the extremely high degree of population decay in vertebrates, even in common “species of low concern.” Dwindling population sizes and range shrinkages amount to a massive anthropogenic erosion of biodiversity and of the ecosystem services essential to civilization. This “biological annihilation” underlines the seriousness for humanity of Earth’s ongoing sixth mass extinction event.
Abstract
The population extinction pulse we describe here shows, from a quantitative viewpoint, that Earth’s sixth mass extinction is more severe than perceived when looking exclusively at species extinctions. Therefore, humanity needs to address anthropogenic population extirpation and decimation immediately. That conclusion is based on analyses of the numbers and degrees of range contraction (indicative of population shrinkage and/or population extinctions according to the International Union for Conservation of Nature) using a sample of 27,600 vertebrate species, and on a more detailed analysis documenting the population extinctions between 1900 and 2015 in 177 mammal species. We find that the rate of population loss in terrestrial vertebrates is extremely high—even in “species of low concern.” In our sample, comprising nearly half of known vertebrate species, 32% (8,851/27,600) are decreasing; that is, they have decreased in population size and range. In the 177 mammals for which we have detailed data, all have lost 30% or more of their geographic ranges and more than 40% of the species have experienced severe population declines (>80% range shrinkage). Our data indicate that beyond global species extinctions Earth is experiencing a huge episode of population declines and extirpations, which will have negative cascading consequences on ecosystem functioning and services vital to sustaining civilization. We describe this as a “biological annihilation” to highlight the current magnitude of Earth’s ongoing sixth major extinction event.
Cheers!
Seems like the increased density that will result with population growth is an opportunity for a new epidemic to happen. While we have better medicines and can recognize diseases faster than in the past, we also have better ways to spread disease and, given enough people, it will be harder to treat them all to prevent disease spread.
https://www.scientificamerican.com/article/what-11-billion-people-mean-disease-outbreaks/
In November, Plug-In Electric Car Sales Hit New All-Time Record – 141,000
Plug-in electric car sales are booming worldwide with a growth rate of 72% in November 2017 and a new all-time record of around 141,000!
The year hasn’t ended yet, but sales already exceed one million (≈1,039,000).
With an upcoming new all-time record expected in December, overall sales in 2017 should be at more than 1,200,000!
In November, China, BYD, BAIC Set All Sorts Of New Plug-In Electric Car Sales Records
The Chinese New Energy Vehicle (all-electric and plug-in hybrids) market reached in November an all-time high of 119,000 units sold (up more than 80% year-over-year).
Better fasten your seat belts before December numbers are in. So far this year, Some 609,000 NEVs were sold in China and still there’s a chance for 800,000 by the end 2017.
According to EV Sales Blog, around 84,500 are passenger plug-in cars (more than 490,000 YTD), which is a new record. Market share for the past month hit a new high of around 3%, while for the past 11-months it stands at roughly 2%.
Just 5% of plug-in car sales in China come from abroad.
Number Of Plug-In EVs On Roads Worldwide Now Exceeds 3 Million
Through the end of November 2017, we are certain that the world’s fleet of plug-in electric vehicles have exceeded a level of 3 million.
This year’s plug-in sales alone already exceed one million, which means that with expected sales of well over 1.7-2.0 million in 2018, we should top ~5 million by the end of 2018.
Currently, EV Sales Blog tally mentions 3.3 million through the end of November.
Many new, better models are coming to the market – while incentives keep gaining strength; this is why we shouldn’t expect anything other than rapid growth … on average of 50-100% annually for quite some time.
With around 80 million cars sold every year worldwide, plug-ins are becoming more and more important.
With demand for new cars increasing by about 2 percent a year, EV’s will shortly fill in the increased demand growth for new cars. Only need to produce 3 billion of them over the next 30 years to takeover fully by 2050. Unless we find a way to not need cars.
Unless we find a way to not need cars.
Even better, we find a way to not WANT cars! After all, what we really NEED is a means of transportation that gets us from point A to point B…
@GoneFishing:
With 70M more people annually I doubt EV production will meet rising car demand for some time.
What those 70M really mean is increasing FF demand to run cars, ships and aircraft. As well as plastics, steel and cement manufacture, space heating, tarmac – the list goes on.
The statistics bear this out, with natural gas, oil and coal consumption all increasing y.o.y. One tends to forget that despite China’s trend towards EV’s they are of course powered 72% by FF. 64% of China’s grid power comes from coal.
JM, you need a bit of reading comprehension. I said that shortly the plug-in production would cover the increased demand growth. Since the EV build rate is much higher than demand increase rate, after that point it will start replacement of the current ICE fleet. Since ICE’s are getting more efficient and EV’s are soon starting the replacement of current ICE’s as well as covering increased demand yoy, I don’t understand your logic that we will use more FF to run cars in the future.
No one is forgetting about coal, if you have been reading my comments I was just discussing coal last week. China and India are particular large problems, both are taking steps to move away from coal. How fast that happens is up to several factors which I discussed in previous comments.
GF, my main point here is that rising population of 1% p.a. is placing relentless upward pressure on FF consumption. That 1% amounts to an extra U. S. each five years.
I maintain that EV production will not be sufficient to counter this for the time being, say five or ten years. EVs themselves not only use FF for power when grid charged, but also in their manufacture.
Agree with most of what you say. Best for next year.
Thanks, have a great year yourself.
EV’s alone will only take some of the demand away when speaking of all FF. They are primarily oil use reduction devices, though use less energy.
For FF demand to fall overall renewable energy (solar. wind, tidal, geothermal) have to also be put in place to a great extent and electrification of heating as well as more industrial process as well. Then the FF energy system drops to about 10 percent or less.
I’ve been looking at the publications from the Centre for Arctic Gas Hydrate, Environment and Climate (CAGE), especially the one cited in the talk by Guy McPherson above:
POSTGLACIAL RESPONSE OF ARCTIC OCEAN GAS HYDRATES TO CLIMATIC AMELIORATION
Abstract:
Seafloor methane release due to the thermal dissociation of gas hydrates is pervasive across the continental margins of the Arctic Ocean. Furthermore, there is increasing awareness that shallow hydrate-related methane seeps have appeared due to enhanced warming of Arctic Ocean bottom water during the last century. Although it has been argued that a gas hydrate gun could trigger abrupt climate change, the processes and rates of subsurface/ atmospheric natural gas exchange remain uncertain. Here we investigate the dynamics between gas hydrate stability and environmental changes from the height of the last glaciation through to the present day. Using geophysical observations from offshore Svalbard to constrain a coupled ice sheet/gas hydrate model, we identify distinct phases of subglacial methane seques- tration and subsequent release on ice sheet retreat that led to the formation of a suite of seafloor domes. Reconstructing the evolution of this dome field, we find that incursions of warm Atlantic bottom water forced rapid gas hydrate dissociation and enhanced methane emissions during the penultimate Heinrich event, the Bølling and Allerød interstadials, and the Holocene optimum. Our results highlight the complex interplay between the cryosphere, geosphere, and atmosphere over the last 30,000 y that led to extensive changes in subseafloor carbon storage that forced distinct episodes of methane release due to natural climate vari- ability well before recent anthropogenic warming.
From the paper:
Despite the growing number of seep-related features that have been recently discovered across the seafloor of the Arctic, shallow gas hydrate systems remain poorly understood and documented, particularly where they have undergone a complex environmental history. This study reveals that abrupt changes in pressure and temperature conditions associated with the interplay of grounded ice, postglacial isostatic rebound, and influx of variable ocean currents all critically modulate the GHSZ [gas hydrate stability zone], thereby driving distinct episodes of natural gas storage and release.
The results aren’t comforting and seem to go directly against a lot of the dismissive statements that were coming from some senior climate scientists only a couple of years ago.
The institute to study hydrates and Arctic climate change was set up in Norway only in 2012 and already has a lot of interesting stuff, and I’d guess it’s only just getting going on publications given the time needed to complete a research project and get through the review and publication cycle.
https://app.cristin.no/projects/show.jsf?id=459944#PUB.TIDSSKRIFTPUBL.ARTIKKEL
Tks for the nice reading list. I’m sure reading some of those papers will cheer me up a bunch!
And a Happy New Year to you!
Feel happy that you have air temperature about 50 degrees warmer than me. No fun having temps 30F below average up here with the wind blowing. Darn global warming has screwed up the jet stream.
Feel happy that you have air temperature about 50 degrees warmer than me.
Sure, why not?!
https://www.youtube.com/watch?v=y6Sxv-sUYtM
Pharrell Williams – Happy (Official Music Video)
Thanks, I prefer this one.
https://www.youtube.com/watch?v=i7X8ZnmLfM0
Pharrell Mashup (Happy Get Lucky) – Pomplamoose
Maybe send it to Guy McPherson 😉
But not to rub it in, I was just out for a walk and today is one of those absolutely perfect Florida winter days! It’s cool and dry without a cloud in the sky.
I was just out for a walk too, cool and dry with a light breeze. A light coating of white particles seems to be covering the ground again. That comes and goes, someone should study that phenomenon. 🙂
I take walks three to four times a day minimum no matter what the weather.
Sadly we are missing out on the really good weather, apparently Erie, Pa has about five feet of snow on the ground and is warmer than here…
Looks like a good book and relevant to what gets posted here.
https://thehumanist.com/magazine/january-february-2018/features/loss-critical-reasoning-harming-america
2017 Arctic Report Card
Highlights
• The average surface air temperature for the year ending September 2017 is the 2nd warmest since 1900; however, cooler spring and summer temperatures contributed to a rebound in snow cover in the Eurasian Arctic, slower summer sea ice loss, and below-average melt extent for the Greenland ice sheet.
• The sea ice cover continues to be relatively young and thin with older, thicker ice comprising only 21% of the ice cover in 2017 compared to 45% in 1985.
• In August 2017, sea surface temperatures in the Barents and Chukchi seas were up to 4° C warmer than average, contributing to a delay in the autumn freeze-up in these regions.
• Pronounced increases in ocean primary productivity, at the base of the marine food web, were observed in the Barents and Eurasian Arctic seas from 2003 to 2017.
• Arctic tundra is experiencing increased greenness and record permafrost warming.
• Pervasive changes in the environment are influencing resource management protocols, including those established for fisheries and wildfires.
• The unprecedented rate and global reach of Arctic change disproportionally affect the people of northern communities, further pressing the need to prepare for and adapt to the new Arctic.
http://www.arctic.noaa.gov/Report-Card/Report-Card-2017
The Unseen World
And the erosion continues. Few people younger than me know that it was once normal to see fields white with mushrooms, or rivers black with eels at the autumn equinox, or that every patch of nettles was once reamed by caterpillars. I can picture a moment at which the birds stop singing, and people wake up and make breakfast and go to work without noticing that anything has changed.
http://www.monbiot.com/2017/12/28/the-unseen-world/
George Monbiot: For more wonder, rewild the world
https://www.youtube.com/watch?v=8rZzHkpyPkc
Happy New Years to friends at Peak Oil Barrel! I hope ya’ll are richly blessed with much happiness, health, and wealth in the new year.
Much is being made in the U.S. media concerning the extremely cold temperatures we’ve been having in the middle to eastern U.S. lately. There is a flip side to those cold temperatures. The far north of North America was exceeding warm relative to their 1971-2000 averages during December 2017. Prudhoe Bay averaged 19.06 F above its 1971-2000 average for December, Iqaluit, Nunnuvut was 12.45 F above its 1971-2000 average and Nome, Alaska was 12.97 F above its 1971-2000 average. Cold air has pushed down from the Arctic into the middle and eastern U.S.
Table I contained temperature deviation values (¬oF) for selected locations in December 2017, for the year 2017 and for the 2010-2017 period relative to 1971-2000 averages:
Time Frame PB* Moosonee Nome Churchill Iqaluit Goose Bay# Yellowknife SSM** Hibbing
Dec. 2017 +19.06 -3.03 +12.97 +0.32 +12.45 +5.61 +5.16 -4.29 -3.26
2017 +6.84 +2.14 +2.19 +2.41 +3.19 +1.60 +3.11 +3.61 -1.01
2010-2017 +4.27 +2.77 +1.48 +3.12 +2.85 +2.37 +3.12 +2.85 +.62
Table I
*PB-Prudhoe Bay, Alaska
**SSM-Sault Ste. Marie, MI
#Goose Bay, Newfoundland
For Sault Ste. Marie, it was the 7th warmest year on record dating back to 1890. Table II contains the top 7 warmest years on record in Sault Ste. Marie.
Year Average Yearly Temperature (oF)
2012 45.71
1998 45.52
2016 44.91
2010 44.77
1931 44.28
2006 43.82
2017 43.80
Table II
December 2017 was the first month since April 2016 in which the monthly average was below the 1971-2000 average for Sault Ste. Marie.
The weather patterns started changing in the 1980’s, got quite severe in the 90’s and 2000’s. There were extreme snow, storm, flooding, drought and temperature events. Lately the jet stream has been slowed so that arctic air masses move south and lock in for up t0 weeks or even months at a time. The next big step in changing this cycle is when the Arctic gets a lot more open water area and days in the summer. 100 year events will become bi-annual or even yearly.
It’s not just here, it’s worldwide. There is no new normal. the climate and weather are moving targets in a more energetic and rapidly changing world.
‘There is no new normal’
If that’s the case, why do these scientists continue reporting temperatures in comparison to normal temperatures from 1980-2010 or years even farther past? Let’s not forget as well, the scientists themselves are gatekeepers of which temperatures should be considered normal because they calculate everything without assistance from outside auditors. Their ethical thing to do would be to just stop reporting on whether temperatures are ‘above’ or ‘below’ a so-called normal level. Tell us instead just the averages along with a big dose of transparency over how the numbers were calculated in the first place.
There are three independent global temperature data sets from different institutions. Your pals the Kochs funded another independent review of global warming data through Berkeley and it actually came out as a stronger indication of anthropogenic warming than previous studies. All scientific papers go through extensive peer reviews – and all reviewers are itching to find errors, I’d guess the climate change ones almost all end up much more conservative than the authors would ideally like. You are a drivelling idiot, but more than that you are a POS creep and if you keep spouting out this bullshit, defaming scientists without evidence based purely on them not giving answers you like, I shall ask Dennis to ban you. If you ever write any such thing on any entry here with my name at the top I shall delete it.
How is it defaming to question clear deficiencies with the scientific process? Science is supposed to be open to constant questioning, but unfortunately it’s now become all political.
Why should any current temperatures be compared to those recorded, for example, between 1970-2000 or 1950-1980, when we have been told repeatedly that the globe has warmed since then, meaning those past records will always show a cold bias compared to the current ones?
The current records should only be compared to the previous year. That way we have an easier time figuring out the natural trajectory of climate change from one year to the next.
This may help you.
https://www.whydoscientists.org/
Hi Tony,
Just comparing to a single year would be silly because temperature fluctuates year to year.
We cannot compare current temperature to future temperature (because we don’t know those yet), so we compare to past temperature. There are many different datasets, all available on the internet, typically temperatures are compared to an earlier 30 year period, but you can use longer periods if you wish.
The Berkeley Earth data (funded initially by climate change skeptics) can be found at the link below.
http://berkeleyearth.org/data/
CHERNOBYL AS A POPULATION SINK FOR BARN SWALLOWS:
TRACKING DISPERSAL USING STABLE-ISOTOPE PROFILES
Abstract. Stable-isotope profiles of feathers can reveal the location or habitat used by
individual birds during the molting period. Heterogeneity in isotope profiles will reflect
heterogeneity in molt locations, but also heterogeneity in breeding locations, because spatial
heterogeneity in molt locations will be congruent with spatial heterogeneity in breeding
locations in species with high connectivity between breeding and molting sites. We used
information on the congruence of spatial heterogeneity in molt and breeding location to study
population processes in Barn Swallows (Hirundo rustica) from a region near Chernobyl,
Ukraine, that has been radioactively contaminated since 1986; from an uncontaminated
control region near Kanev, Ukraine; and from a sample of pre-1986 museum specimens used
to investigate patterns prior to the nuclear disaster at Chernobyl, from both regions. Previous
studies have revealed severe reductions in Barn Swallow reproductive performance and adult
survival in the Chernobyl region, implying that the population is a sink and unable to sustain
itself. Female Barn Swallows are known to disperse farther from their natal site than males,
implying that female stable-isotope profiles should tend to be more variable than profiles of
males. However, if the Barn Swallows breeding at Chernobyl are not self-sustaining, we would
expect males there also to originate from a larger area than males from the control region. We
found evidence that the sample of adult Barn Swallows from the Chernobyl region was more
isotopically heterogeneous than the control sample, as evidenced from a significant
correlation between feather d13C and d15N values in the control region, but not in the
Chernobyl region. Furthermore, we found a significant difference in feather d15N values
between regions and periods (before and after 1986). When we compared the variances in
d13C values of feathers, we found that variances in both sexes from post-1986 samples from
Chernobyl were significantly larger than variances for feather samples from the control
region, and than variances for historical samples from both regions. These findings suggest
that stable-isotope measurements can provide information about population processes
following environmental perturbations.
http://cricket.biol.sc.edu/chernobyl/papers/moller-et-al-chernobyl-isotopes-2007.pdf
On a more general note: “Barn Swallow populations declined by over 1% per year from 1966 to 2014, resulting in a cumulative decline of 46%, according to the North American Breeding Bird Survey.”
I say that is indicative of a major environmental problem in North America and South America.
Barn Swallow populations declined by over 1% per year from 1966 to 2014, resulting in a cumulative decline of 46%
During that same period the human population in the US increased by roughly 60%.
Maybe the number of new barn constructions was significantly reduced… /sarc
Maybe they are just slow mentally (or starve to death which is an activity you get to do only once).
Their relative the Cave Swallow did a big population turnaround from being a rare bird in the 1960’s by adapting from caves to artificial nesting areas (bridges culverts, silos, buildings) and is now a locally common bird.
But it probably is the insect population they depend upon fading out, much like what has happened to that beautifully colored little falcon, the American Kestrel.
The American Kestrel is the continent’s most common and widespread falcon but populations declined by about 50% between 1966 and 2015, according to the North American Breeding Bird Survey. Partners in Flight estimates the global breeding population at 4 million, with 39% spending some part of the year in the U.S., 10% in Mexico, and 13% breeding in Canada. They rate an 11 out of 20 on the Continental Concern Score and are not on the 2016 State of North America’s Birds’ Watch List. Current declines stem from continued clearing of land and felling of the standing dead trees these birds depend on for their nest sites. The American Kestrel is also losing prey sources and nesting cavities to so-called “clean” farming practices, which remove hedgerows, trees, and brush. An additional threat is exposure to pesticides and other pollutants, which can reduce clutch sizes and hatching success. For kestrels in North America, a larger problem with pesticides is that they destroy the insects, spiders, and other prey on which the birds depend.
Bold mine.
I know that the kestrels have disappeared from my area but are still somewhat viable in the next state over. There is an active kestrel nesting program going on over there. Still, not common at all anymore.
I feel that house cats are impacting bird populations much more than is generally known.
http://www.businessinsider.com/cats-kill-billions-of-birds-and-mammals-each-year-2014-12
If you want to save birds then kill cats. A sock full of catnip thrown in the middle of the freeway is an economical method.
For Fred: a list/timeline of hot editors:
https://xkcd.com/1823/
CGTTATGATTGATTGTAGTCGTGAAGCACTCTCTACAGCCGTACTGAGGAGGACAGCCTCCTAATGAGCGACCTAACTCACTAATCGACT
http://earthsciweb.org/js/bio/dna-writer/
ATCTGTATCAGCACTCTCTACAGCTAGTGTAGCGACTGTGAT
What is our vision of the future? Whatever it is the results of our present indicate a future much different than now. While we seem concerned about the loss of energy and materials we are mostly ignoring the loss of life. Considering the stories I have read of the early settlers of North America and it’s early explorers, the North American continent was abundant with life just a few centuries ago. Those days are long gone and the remnants of that grand diversity of life are fast reducing and disappearing. Is that what we want?
Dramatic population reductions of a single fish species in a South American river could degrade ecosystem function in an entire river system, according to an article in the Aug. 11 issue of the journal Science
https://phys.org/news/2006-08-declining-fish-population-broad-ecological.html#jCp
We may not miss the phantom shiner, the thicktail chub, the stumptooth minnow or the harelip sucker, but these freshwater fishes are among 39 species (3.2 percent of North America’s freshwater fish population) and 18 subspecies that have vanished from the continent’s waters over the past century. By 2050 the tally could reach as high as 86, an extinction rate that is about 877 times higher than normal and that has accelerated in the past 20 years, according to a study in the September issue of BioScience. When so many fish disappear in a short period, “you know something’s up,” says study author Noel M. Burkhead of the U.S. Geological Survey.
https://www.scientificamerican.com/article/freshwater-fish-dying-alarming-rates/
What is our vision of the future? Whatever it is the results of our present indicate a future much different than now. While we seem concerned about the loss of energy and materials we are mostly ignoring the loss of life.
I have been a lifelong student and explorer of fresh water and marine ecosystems. Unfortunately that has given me a front row seat to the unfolding tragedy of the destruction of many of those ecosystems.
This quote from the George Monbiot article you posted earlier is something that really hits very close to home,
“To be aware of the wonders of the living planet is to take on an unbearable burden of grief”
And if anything, it should be the exact opposite but alas I have witnessed things that have literally made me want to cry. Which is why, If I could, sometimes I feel like taking a baseball bat to the heads of the ignoramuses that pontificate about the absolute importance of the ‘Economy’,uber ales, without having the slightest clue that the ‘Economy’ is just a second or third string subsidiary of Ecosystems Inc.
C’est la vie!
“Only when the last tree has been cut down, the last fish been caught, and the last stream poisoned, will we realize we cannot eat money.”
https://www.youtube.com/watch?v=8V06ZOQuo0k
The Lorax (original)
I see so many obvious things that are completely missed by most people. Probably the most important course in the world for young people would be how to actually see, how to perceive and look at the world so they actually know where they live.
One cannot miss what one never saw in the first place. They look but they do not see, and many never even look.
We are now so far beyond the time to fight among ourselves for the imagined rewards of life that it is a testament to the low mentality of humans. In a time when everyone needs to get together and work toward common goals for the survival of life, the same old memes of hatred and division are being strengthened by a core of sociopathic monsters taking advantage of the weak minded and poorly raised.
In a time when our knowledge and vision is the greatest, most do not even see reality and aim their energies at the wrong targets pushing us further over the cliff.
“When they remember they are men, they will be free.” Kwai Chang Caine
“Close your eyes. What do you hear?
“I hear the water. I hear the birds.”
“Do you hear your own heartbeat?” “No.”
“”Do you hear the grasshopper which is at your feet?”
“Old man, how is that you hear these things?”
“Young man, how is it that you do not?”
Mater Po questioning young Caine
“”All creatures, the low and the high, are one with nature. If we have the wisdom to learn, all may teach us their virtues. Between the fragile beauty of the praying mantis and the fire and passion of the winged dragon, there is no discord. Between the supple silence of the snake and the eagle’s claws, there is only harmony. As no two elements of nature are in conflict so when we perceive the ways of nature, we remove conflict within ourselves and discover a harmony of body and mind in accord with the flow of the universe.”
-Master Kan
We are in conflict with both each other and nature itself.
“If you can’t be a poet, be the poem.” David Carradine
Between the fragile beauty of the praying mantis and the fire and passion of the winged dragon, there is no discord.
Maybe you should listen to what the praying mantis has to say…
.
I have not seen a praying mantis in many years, so that says to me that there is something very wrong. The silence is screaming to any who listen. The absence is sorrowful as a grave yard.
Fred, many years ago when Kung Fu was airing, I wrote a letter to Warner Brothers and asked them about the philosophy behind the program. They sent me a list of references that the writers used, all ancient philosophy and Taoist teachings. That show was probably more realistic than most imagine.
Sadly, the world is not a Temple and it has monsters roaming the land.
“Perceive the way of nature and no force of man can harm you. Do not meet a wave head on: avoid it. You do not have to stop force: it is easier to redirect it. Learn more ways to preserve rather than destroy. “-Master Kan
Happy New Year to all! Here’s hoping that your’s has started better than mine. I was received a phone call on the evening of new year’s day from the fellow who I left to take care of my rural homestead, telling me than one of the two dogs had died of suspected poisoning. I got the dogs to try and secure the property, to prevent people from just trespassing on the property whenever they feel like. A neighbor who insists of using the property as pasture for his goats is suspected of doing the deed, having broken the leg of the surviving dog earlier this year when my dog wouldn’t allow him to access my property unmolested! Of course since dogs can’t talk and any witnesses are likely to be members of the suspect’s family, I can’t prove anything. At any rate, it is obvious to me that the dogs are somewhat effective as someone seems intent on getting rid of them.
At this point I am fed up. The presence of the goats makes it extremely challenging to practice agriculture on the property and the laws of Jamaica do not permit the slaughter of grazing animals unless the property is completely fenced. The laws also do not permit the slaughter of other peoples dogs but some people observe the laws while others do not. For anyone who thinks I should go to the police, I invite you to walk into a Jamaican police station and try to report that you think someone has poisoned your dog! (you’d get a better response by reporting that someone had shot your dog).
My first impulse is to sell the property, preferably to someone who is amenable to solving these matters in a efficient but, ruthless fashion, the laws be damned. On second thoughts, I’ think I should offer a deal to Caelan, six acres with a house built for the wealthy land owner, I’d estimate more than 80 years ago, maybe as much as 100 years ago. There have been several additions and changes to the house over the years with the result that the oldest section, constructed with wood (mostly pine), is now divided into a three bedroom, one bathroom dwelling with another two bedroom, one bathroom dwelling attached, There is also a one bedroom, one bathroom semi-detached apartment with much more modern steel reinforced, cinder block walls. There is a rainwater catchment system with a little over 5,000 gallons and there is also a connection to the local, unreliable, public water supply that has not been used for years. The land has a wide variety of trees on it including coconuts, pimento (allspice), nutmeg, avocado, mango, breadfruit, ackee, cedar, mahogany, blue mahoe and even three African Oil Palm plants, among others. There is maybe an acre of chocolate plants and another couple acres of bananas and plantains. Right now I’d be willing to strike a deal with Caelan so that, he could come here, practice his permaculture to his hearts content, deal with the state of semi anarchy he so seems to espouse and fight the goat herders termites and the ever increasing tropical heat and humidity.
I on the other hand, am seriously considering migrating to some first world country, so I can continue “uncritically masturbating to the fruits of the crony-capitalist plutarchy” for the rest of my days. I am rather fond of dogs and would prefer the company of my dog to that of some two faced, backstabbing human being but, we all know that is not how things work. The dog is gone and her killers are still at large.
Sorry about your dog! Have you thought about putting up a solar charged electric fence? It might keep both humans and goats at bay…
As for the thought of Caelan setting up a permaculture center in Jamaica, LOL! that’s just too damn funny!
BTW, a while back you asked me to send you an email, which I did. Maybe it got lost in your spam filter. My email is fred dot magyar at gmail dot com
Eat the goats.
Islandboy – my sincere condolences on the loss of your dog. I’m sure you are a much better person than I who would immediately direct my grey cells into full time revenge mode following your awful experience. My old dog died a natural death three months ago and I think about him every day.
Motion activated sprinklers might keep them away from selected areas.
Shoot (with a crossbow)-shovel-shut up works around my area- “Goat? What goat? You’re missing a goat? Gee, that’s too bad… I haven’t seen one… lately.”
I had a dick head neighbor once so I scattered poison ivy seeds all over his property and chucked dried kibble under all his decks and sheds. He’s still a dick head, but now he’s a dick head with bigger problems.
Sorry to here your story Island Boy. Bad people can wreck a nice scene, in your backyard or on the planet at large.
I like the C.S. (caelan solution). After a couple years down there, his postings might become relevant. I’d feel sorry for the remaining dog however.
Just like to disrupt the myth that electric cars will use more energy. The waste energy that is used by the production, refining and transport of oil more than covers all the energy that EV’s will use. So all that coal, oil, natural gas and electricity that go into the refining and production of oil will no longer be needed. Basically, the EV will run on the production energy (waste) of oil and all the oil energy that was used for transport will not be needed. So any comparison between EV’s and ICE efficiency is just hot air.
Energy to produce and distribute ICE fuel > energy needed to run all the electric cars
Extra energy to move EV’s = ZERO
Civilization will actually use less energy than that since the maintenance is less on EV’s and the pollution factors will be greatly reduced.
Even better news: The EV is not near it’s efficiency limits
Civilization will actually use less energy than that since the maintenance is less on EV’s and the pollution factors will be greatly reduced.
Which means that EVs could greatly contribute to a reduction in global dimming thereby causing a sudden major spike in average global temperatures.
At this point since it seems 3°C to 5°C average temperatures are pretty much already baked into our current BAU track, we need to develop technologies that can remove billions of tons of CO2 from the atmosphere and then safely store them in some way. That’s probably just a pipe dream but there are some ideas out there like this one:
https://www.cbsnews.com/news/scientists-seek-holy-grail-of-climate-change-removing-co2-from-the-atmosphere/
Scientists seek holy grail of climate change: Removing CO2 from the atmosphere
paging Doug Leighton for opinion on feasibility of such a process…
I guess we have a couple of issues that need to be resolved before our Dyson Sphere is fully deployed…
“paging Doug Leighton for opinion on feasibility of such a process…”
Why pick on me? Well, as you know, removing carbon dioxide from the atmosphere is called “negative emissions”. I expect our ability to develop (and scale up) relevant technology quickly enough to make a dent in climate pollution is doubtful. On the other hand, it could be we’re near a tipping point in terms of climate consequences and appropriate funding and technology may follow quickly.
Why pick on me?
Because you’re the closest thing here to a Geophysicist 😉
…That has injected new urgency into the work underway in Oman, where Keleman’s team recently spent four months extracting dozens of core samples, which they hope to use to construct a geological history of the process that turns CO2 into carbonate.
“It’s like a jigsaw puzzle,” said Nehal Warsi, 33, who oversees the drilling process.
Around 13 tons of core samples from four different sites will be sent to the Chikyu, a state-of-the-art research vessel off the coast of Japan, where Keleman and other geologists will analyze them in round-the-clock shifts.
They hope to answer the question of how the rocks managed to capture so much CO2 over the course of 90 million years – and to see if there’s a way to speed up the timetable.
Umm, I don’t think we can wait another 90 million years…
The effects of EV is primarily an oil reduction device, though it does reduce the use of some other fossil fuels. Coal burning is a big factor in global warming so removing the oil burn would not remove global dimming. Of course the EV might take 30 to 50 years to do this anyway. We should have more answers long before that time.
The effects of attempted CO2 removal and sequestration have been seriously modeled and are somewhat astounding, as the article below from Scientific American will explain. However, as far as temperature reduction goes, by the time we institute a global system of CO2 removal tipping points may be well past so it might have little effect anyway. Also, at the very same time we would need to stop producing CO2 in large quantities otherwise we are just fooling ourselves.
https://www.scientificamerican.com/article/sucking-co2-from-the-air-would-not-halt-effects-of-global-warming/
Another factor is political. With massive interference to the global weather system, if and when monsoons shift and people start starving, the system of removal would be required to shut down or military and paramilitary attempts to shut it down would be made. It does not matter if the removal was the cause or not, it would be blamed. Wars and rebellions might very well ensue and the removal system would be crippled or just shut down.
But still, it will most likely be attempted as the temperature keeps rising and we are unsuccessful in stopping the FF burn.
But still, it will most likely be attempted as the temperature keeps rising and we are unsuccessful in stopping the FF burn.
Well, I guess we’re all pretty much fucked then! As both you and the SciAm article conclude…
Sans reduced emissions, using extreme geoengineering to remove atmospheric carbon dioxide would not protect the oceans, models show
Still, I do consider it to have been an immense privilege to have lived at a time when I could still see the oceans teeming with life. R.I.P.
.
How long has coral been around? Maybe some of them can exist in a more acidified ocean.
I remember snorkeling over the corals along Maui, back in the 90’s. Fantastic and the fish life was amazing. Wonder what that looks like now.
HOW CLIMATE CHANGE DENIERS RISE TO THE TOP IN GOOGLE SEARCHES
“The proliferation of climate disinformation, both online and off, has coincided with an effort to undermine measures to combat climate change. Republican leaders regularly question climate science and President Trump has called climate change a hoax. He announced plans to withdraw from the global Paris accord on climate change and is aggressively rolling back environmental regulations.”
https://www.nytimes.com/2017/12/29/climate/google-search-climate-change.html
HOW CLIMATE CHANGE DENIERS RISE TO THE TOP IN GOOGLE SEARCHES
Just use Google Scholar instead of regular Google search. 3.4 million hits for ‘Climate Change’, not a single denialist in sight! I guess they can’t pass peer review.
No political ads one way or the other either.
It’s not me I worried about!
WE MUST NOT BELIEVE IN GOOGLE ABSOLUTELY!
A man took a lady out to dinner for the first time. Later they went on to a show. The evening was a huge success and as he dropped her at her door he said ‘I have had a lovely time. You looked so beautiful, you remind me of a beautiful climbing rose. May I call on you tomorrow? She agreed and a date was made. The next night he knocked on her door and when she opened it she slapped him across the face and knocked him A over T. He was stunned. ‘What was that for?’ he asked.
She said… I looked up “beautiful climbing rose” on Google last night and it said…..”Best suited for rooting against a brick wall or a fence, no good in an open bed.”
Maybe the schools need to teach how to discern deceit from honest results. There are certain indicators in the language and format of purposeful and follower deniers that could be used to quickly identify them.
The scum is stating to leave:
Utah Sen. Hatch says he is retiring after 7 terms
http://www.sfgate.com/news/politics/article/Hatch-announces-he-will-not-seek-re-election-12467548.php
But we will get Romney instead– a slight improvement, if you hold your nose and dodge the corporate giveaways.
Donald is a bit for even the sociopaths to handle.
USA has been a political sewer pipe for a long time. The sewer pipe is now clogged and the shit is backing up. The smarter ones will vote with their feet and just leave.
THE COGNITIVE SCIENCE BEHIND CLIMATE CHANGE DENIAL
https://terrainforma.ca/2018/01/01/cognitive-science-behind-climate-change-denial/
Interesting to note the large increase in Republican base approval for Putin that occurred from 2015 to 2017. What a bunch of sheeple.
2017 was the hottest year without an El Niño by a wide margin – a whopping 0.17°C hotter than 2014, which previously held that record. Remarkably, 2017 was also hotter than 2015, which at the time was by far the hottest year on record thanks in part to a strong El Niño event that year.
https://www.theguardian.com/environment/climate-consensus-97-per-cent/2018/jan/02/2017-was-the-hottest-year-on-record-without-an-el-nino-thanks-to-global-warming
Record-Setting Cold Shakes Up America’s Commodities Markets
By Brian K Sullivan January 2, 2018, 1:36 PM CST
https://www.bloomberg.com/news/articles/2018-01-02/record-setting-cold-roils-markets-from-heating-fuel-to-wheat
A record-breaking cold that’s threatening to spur heating-fuel shortages from the East Coast to Texas has driven up natural gas demand to unprecedented levels and put crops across the U.S. wheat belt at risk.
Wind chill advisories and freeze warnings blanket the central U.S., while winter storm watches are in place from Massachusetts to Florida. Ice has slowed fuel deliveries from New York harbor, the gasoline and diesel hub for the region, while power prices are trading near multi-year highs.
“It is very cold and in a lot of places it is record cold,” said Bob Oravec, a senior branch forecaster at the Weather Prediction Center in College Park, Maryland.
A winter storm that’s set to race up the East Coast on Wednesday offers to provide some respite from the bone-rattling cold. But any relief will only be temporary as the Arctic chill is set to make a comeback by the end of the week.
“This is only the appetizer — the main meal comes over the weekend,” said Judah Cohen, director of seasonal forecasting for Atmospheric and Environmental Research, a Verisk Analytics Inc. business in Lexington, Massachusetts. “This is about as intense a cold as I can remember.”
Boston hasn’t reached 32 degrees Fahrenheit (0 Celsius) — the freezing mark — since Christmas, according to the National Weather Service. New York’s LaGuardia and John F. Kennedy airports have set new records while Chicago had its coldest New Year’s Day ever.
Boston’s set to tie a 100-year-old record with seven days of high temperatures below 20 degrees, said Bill Simpson, a weather service meteorologist in Taunton, Massachusetts.
This will make it difficult for democrats to turn climate change into a campaign issue during the elections later this year.
Yep, a certain portion of the population (forgetting those warm snowless winters) gets brainfreexe very quickly whenever there is a cold weather event. It’s the same people every year so won’t change anything politically.
Why their brains don’t unfreeze in the warm weather is worth funding a study.
Given how stupid the average American is I tend to agree.
Americans Will Eat a Record Amount of Meat in 2018
By Megan Durisin and Shruti Singh January 2, 2018, 4:00 AM CST
https://www.bloomberg.com/news/articles/2018-01-02/have-a-meaty-new-year-americans-will-eat-record-amount-in-2018
For all the buzz about pea protein and lab-grown burgers, Americans are set to eat more meat in 2018 than ever before.
To be precise, the average consumer will eat 222.2 pounds (100.8 kilos) of red meat and poultry this year, according to the U.S. Department of Agriculture, surpassing a record set in 2004. Meanwhile, domestic production will surpass 100 billion pounds for the first time, as livestock owners expand their herds on the back of cheap feed grain.
Many Americans are actively shunning carbohydrates in favor of protein, though any health benefits may be outweighed by the sheer volume of meat, eggs and dairy being consumed. While the government recommends that adults eat 5 to 6.5 ounces of protein daily, the USDA forecasts the average person will down almost 10 ounces of meat and poultry each day in 2018.
It’s a sharp turnaround from 2007 through 2014, a time when per-capita meat and poultry demand slumped 9 percent as rising corn-based ethanol demand and a drought sent commodity prices sharply higher.
This was in the Times today, written by a leading nutritionist:
I’ve seen first-hand that people whose diets are high in red meat have significantly higher health risks. Heavy meat consumption has also been linked to depression, loss of mental concentration and dementia.
I think Trump eats a lot of burgers.
Yep.
>> … Trump’s McDonald’s order consisted of “two Big Macs, two Fillet-O-Fish, and a chocolate malted,” which adds up to a whopping 2,430 calories. <<
http://uk.businessinsider.com/corey-lewandowski-trump-mcdonalds-fast-food-2017-12
Sounds like about 4 day’s worth of salt as well.
If we’re lucky he’ll have a stroke and he can drool and suck apple sauce through a straw for a decade or two before he takes a dirt nap.
…. some kind of bowel loosening stroke on live TV would be interesting.
Well now this ongoing great north American deep freeze is so remarkable there’s a wiki page already. https://en.m.wikipedia.org/wiki/2017%e2%80%9318_North_American_cold_wave
https://en.m.wikipedia.org/wiki/2017%E2%80%9318_North_American_winter
Looks like the economic toll, and therefore a lot of individual stress, in the USA from anthropogenic weather weirding is starting this year as high as it was through last. I wonder what new surprises will come up through the year – although next week the whole of the mainland USA is due to be about 5 degrees C above average.
Why don’t they remember the warm winters? Maybe they should write things down.
Weather changes beat global changes by a large margin. It can be 30F higher or lower on a daily basis which makes the 5F global change range over the century appear as small or inconsequential to the man in the street.
Yep amazing! There’s also a wiki page already about Climate Change Denialism. Imagine that!
https://en.wikipedia.org/wiki/Climate_change_denial
Of the world’s countries, the climate change denial industry is most powerful in the United States.[23][24] From 2015 to 2017 (after having already served from 2003 to 2007), the United States Senate Committee on Environment and Public Works was chaired by oil lobbyist and climate change denier Jim Inhofe, who had previously called climate change “the greatest hoax ever perpetrated against the American people” and claimed to have debunked the alleged hoax in February 2015 when he brought a snowball with him in the Senate chamber and tossed it across the floor.
BTW, while it is now winter in the Northern Hemisphere in the Southern Hemisphere it is summer… This is what it was like last year in Australia.
https://www.theguardian.com/australia-news/2017/feb/19/australia-new-normal-47c-climate-change
Sydney Dispatch
Australia’s new normal … as city temperatures hit 47C people shelter from the deadly heat
In Sydney’s baking suburbs, fans have sold out – and fears about the effects of climate change are mounting
There are a lot of Climate Change Denialists in the Australian Government as well!
Global temperature rise by latitude shows the northern regions and especially the Arctic having a very high rate of change.
Which is why, every so often, the jet stream buckles and the still cold, but not quite as cold on average, arctic winter air gets shoved down over the USA or parts of southern Europe and Asia, while the Arctic takes those areas’ usual weather and gets even warmer for a few days.
So even with all the extreme records this cold snap has set, you still say this Arctic air isn’t “quite as cold” as years past?
WTF?! Are you really as dumb as you seem, or do you get paid really big bucks just to pretend to be an absolute moron?! Maybe you get all your information from Fox News.
https://www.scientificamerican.com/article/the-arctic-is-getting-crazy/
The Arctic Is Getting Crazy Feedback loops between record Arctic temperatures and the jet stream may be altering our weather
In the past year the climate in the Arctic has at times bordered on the absurd. Temperatures were 30 to 50 degrees Fahrenheit above average in some places during the recent Christmas week. Through November the area of ice-covered ocean in the region reached a record low in seven of 11 months—an unprecedented stretch. More important, perhaps, the difference between Arctic temperatures and those across the midlatitudes of North America, Europe and Asia during 2016 was the smallest ever seen…
…How unusual is the ongoing string of Arctic climate records?
The records are astounding because there are so many of them. The extra warming that is happening up in the Arctic—the “Arctic amplification”—has been the greatest we’ve ever seen. We’ve also seen the lowest sea-ice thickness, and we’ve seen the greatest amount of water vapor in the atmosphere. That one doesn’t usually make headlines but it should; that water vapor comes from more evaporation because there is more exposed, open ocean. Also, a lot more water vapor is being transported northward by big swings in the jet steam. That’s important because water vapor is a greenhouse gas just like carbon dioxide and methane. It traps heat in the atmosphere. That vapor also condenses as droplets we know as clouds, which themselves trap more heat. The vapor is a big part of the amplification story—a big reason the Arctic is warming faster than anywhere else.
Thanks for coming out short bus.
If you are looking at parsing my language in a hastily knocked off comment to support your denier delusion you really are desperate. The air is from the Arctic, it is still extremely cold there in the winter, and it happens now to be in the USA, where it shouldn’t by rights be. And the cause of that is overall average warming. Or do you only have binary words for weather like hot/cold that’s it – try some adjectives, or better still look at the actual numbers and try charting them yourself.
WILDFIRES TO HURRICANES, 2017’S YEAR OF DISASTERS CARRIED CLIMATE WARNINGS
“A common feature of the hurricanes and the wildfires is that there have been many warnings from scientists and others,” explained Kevin Trenberth, a climate scientist with the National Center for Atmospheric Research. “With climate change, one slows or stops the problem (mitigation) or adapts to the problem (builds resilience) or suffers the consequences. In Texas, Florida and Puerto Rico, and Santa Rosa, it is clear that the people have chosen the last option.”
https://insideclimatenews.org/news/29122017/hurricanes-fires-drought-2017-year-review-climate-change-disasters-new-normal
HOW BIG OIL LOST CONTROL OF ITS CLIMATE MISINFORMATION MACHINE
“The basic parameters of the long-term threat posed by climate change were well described and known by 1979,” Brulle of Drexel said, referring to a major report on climate change issued by the National Academy of Sciences. “But here we are, coming up on nearly 40 years, and there still is confusion and a lack of willingness to act. So I guess in that sense, the effort to stop climate action has won, as if this is a winning position in any sense of the term.”
https://insideclimatenews.org/news/22122017/big-oil-heartland-climate-science-misinformation-campaign-koch-api-trump-infographic
If you REALLY want to know what’s going on in the political arena, it pays to at least skim the opposition camp news on a regular basis.
So… this is a CNN link but it’s about Bannon, the Trump campaign and the Russian connection.
http://www.cnn.com/2018/01/03/politics/steve-bannon-guardian-russia-analysis/index.html
The last few words:
xxxx
But, this Trump Tower meeting is the other side of that coin. It was a colossally bad decision — even if nothing at all happened in it.
Say what you will about Steve Bannon — and you can say a lot — but he gets that. And he gets — better than anyone in the White House apparently does — what is headed their way.
“They’re sitting on a beach trying to stop a Category Five,” he told Wolff.
xxxx
I wish I had noticed this little gem sooner, but somebody beat me to it.
M A G A
Mueller Ain’t Going Away.
This Guardian link has a lot more info, and some embedded links too.
https://www.theguardian.com/us-news/2018/jan/03/donald-trump-russia-steve-bannon-michael-wolff
Good to see you back farmer Mac. I was beginning to wonder if something happened to you.
OldMacDonald aka KGB Trumpster, it was fools like you who spread the Russian propaganda because of your hate
“The ability to understand a question from all sides meant one was totally unfit for action. Fanatical enthusiasm was the mark of the real man.” ~ Thucydides
https://www.msn.com/en-us/news/factcheck/in-a-30-minute-interview-president-trump-made-24-false-or-misleading-claims/ar-BBHuIgy?ocid=spartandhp
“There is no evidence that Hillary Clinton campaigned for the popular vote, which Trump has previously has said he would have won if not for fraud. Clinton campaigned in many battleground states, including Republican-leaning ones where she thought she had a chance. She did not campaign as much in two states — Michigan and Wisconsin — that were considered locks for Democrats but which Trump narrowly won. Clinton won the popular vote by nearly 3 million. If 40,000 votes had switched in three states, Trump would have also lost the electoral college.”
I wonder how many of those forty thousand could easily have been flipped had the D’s, and D partisans, been a little more civil, shown a little more respect for the beliefs, worries, hopes, and fears of the people that voted for Trump.
My guess is that forty thousand, times three or four or more.
The people that were SURE to vote D were already on board. Catering, or pandering, more like it, to them, was totally unnecessary.
It’s not hard to make a good argument that had the liberal establishment been a little less condescending, a little less nose in the air, a little less arrogant about claiming liberal preferences and prejudices are morally and ethically superior to conservative, religious, and working class prejudices, well……. Trump wouldn’t be the president today.
People get MAD when you insult them, whether the insult is justified, or not. They give you the middle finger.
Control of the lower house of the government of Virginia is down to JUST ONE VOTE.
I have spent almost my entire life in Virginia, and know the people well, from the coal fields to the ‘burbs of DC, and out to the coast.
It’s true that Trump type poison rhetoric gets out some R voters, especially when they have an opportunity to vote for somebody they have known and loathed for a generation plus, such as HRC.
But there would have been hundreds more middle of the road people voting D in that district, if it hadn’t been for so many liberals consistently describing them as ignorant, superstitious, selfish, racists, xenophobic, take your choice.
It’s altogether possible to say things that need to be said, such as advocating for clean air and clean water laws, without insulting people who don’t support such laws for various reasons, which are mostly beyond their own control.
It’s altogether possible to win them over, if you have patience, and take your time and slip inside their mental fences and explain to them, in terms they can understand, why we need such laws. It won’t happen overnight, but it can and does happen over a period of time, sometimes as little as a year or two.
I’ve converted a couple of hard core right wing people who are desperately sick simply by explaining to them that if we get single payer health care, in terms they understand, that their money problems with health care will pretty much go away.
You don’t get their attention by broad casting your opinion that they are too stupid to know what’s good for them, and what’s not.
OldMacDonald aka KGB Trumpster, you are the biggest blind political idiot I have ever witness. You are motivated by hate. The country is in crisis and Trump couldn’t do more damage if he was a Russian asset. Pull your head out of your ass and get over your HRC hate.
Steve Bannon calls Trump Tower Russian meeting ‘treasonous’ in new book
https://www.nbcnews.com/politics/white-house/steve-bannon-calls-trump-tower-russian-meeting-treasonous-new-book-n834286
He’s taking a heavy run at Kushner. I hope he succeeds.
Even pretty smart people are often better described as fart smellers. Knowing only a little, or even a lot, can be a problem, because even a lot may not be enough to prevent the making of some very bad decisions.
One that’s been made, and will probably continue to be made, is to cut vast acreages of timber, leaving a moonscape, hauling the wood up to a couple of hundred miles on trucks and or trains, maybe, spending more energy and money drying, grinding, and pelletizing it, loading it on ships, hauling it thousands of miles farther, hauling it again off the ship to a power plant, and finally burning it, with the expressed goal being reducing co2 emissions.
This is an idiotic policy, in the same league as adding moonshine to most of our Yankee gasoline, because when all is said and done, there’s probably little or nothing saved even in terms of overall emissions associated with generating electricity.
On the other hand, the land so stripped is desperately needed for ecosystem services, and probably within the next decade or two, it will be needed for food production as well.
I’ve gone to the trouble of putting the message in plain language and only a few words to save those with short attention spans the trouble of reading the link.
https://www.theguardian.com/environment/2017/dec/31/biomass-burning-misguided-say-climate-experts
” In generating exactly the same amount of electricity, wood will release four times as much carbon into the atmosphere as gas would do, and one and half times as much as coal. In addition, energy is used in harvesting and transport while vast stretches of land are needed to create the forests to supply generating stations with the wood they need. This also has profound environmental impacts for a world that will soon be home to more than 10 billion humans who will need every scrap of productive land to provide food.
Over the past decade, Europe has increased its use of renewable energy sources to provide it with power, and about half of that rise has come from burning biomass. Unfortunately, says Beddington, if that increase continues Europe will soon need to burn an amount of wood greater than its total harvest and would have to seek sources from other continents. Either land for farming would be turned to biomass growing or precious natural habitats will be exploited, most probably the latter. “If Europe chooses this route, it seems likely that a consequence will be vastly greater removals which will come mostly from natural forest globally,” he states.
Given that forests like those of the Amazon absorb massive amounts of carbon dioxide, this destruction would only worsen the planet’s climate woes. “The result of promoting a system of biomass electricity from dedicated tree harvesting will in all realistic scenarios mean there will be substantially more carbon in the air for decades, regardless of the type of forest and no matter how sustainably they are managed,” he says.
He calculates that carbon emissions will rise by 6% or possibly more if wood is allowed to continue to provide more and more of Europe’s energy output, rather than a reduction of at least 6% that would come from using other renewable sources, such as solar or wind power.”
“In the middle of the 19th century, wood burning rose to such levels that western Europe was almost completely deforested. Ironically, the rise of coal burning saved the situation. Now that coal is being phased out, it should not be an excuse to return to widespread tree burning, say researchers. Instead we should concentrate our efforts to boost solar and wind projects and other less harmful sources of renewable energy.”
Guardian writers generally get it right, but I fear the editors may think it’s best to support continued investment in renewable energy, rather than focus on conservation and efficiency.
But there’s a world of cheap, easy, juicy low hanging fruit to be hand by way of improving our energy efficiency.
I’m all for staying pedal to the metal on wind and solar power, but backing off on conservation and efficiency is a MAJOR mistake.
Offshoring business and industry in order to achieve environmental goals is a MAJOR mistake, especially if the goal is to reduce green house emissions. It takes the wind only a few weeks to move newly generated CO2 from China to the Yankee Land.
Now if well educated and well intentioned and environmentally aware people, people with the time, energy, and opportunity to know the score, are ignorant enough to fall for this scheme , which really doesn’t benefit anybody but the people who own the timber, and the people who have jobs associated with processing and delivering it, is it any surprise that LESS educated people fail to understand environmental issues ?
60 Environmental Rules on the Way Out Under Trump
https://www.nytimes.com/interactive/2017/10/05/climate/trump-environment-rules-reversed.html
Which leads to one question, how do any of these mofos sleep at night?
Con men, shysters, and gangsters are sociopaths and do not have empathy for the rest of the people, at most their immediate family and cronies if they stay in line.
America and the world is up for grabs by these people, a way to make money. It’s a racket.
Folks this is record cold air coming into the US.
Record Cold.
https://qz.com/1169540/sharks-are-freezing-to-death-in-the-us-due-to-a-record-cold-winter/
So what’s your point?
Most of the world’s coral reefs are suffering bleaching and die off due to severe heat stress.
https://coralreefwatch.noaa.gov/satellite/analyses_guidance/global_coral_bleaching_2014-17_status.php
This is easy to confuse, but the air is record cold only relative to records in the United States. If the air had stayed in the arctic, no records there might have been broken, and the air wouldn’t be described as record cold.
This article is modeled after Jeff Foxworthy’s routine “You might be a redneck if..” Pure entertainment for the simpleminded.
This seems to back up a recent post by Gerry
Using gravity to watch a changing earth
https://media.ccc.de/v/34c3-8964-watching_the_changing_earth
http://onlinelibrary.wiley.com/doi/10.1002/2017GL075419/full
Geophysical Research Letters
Ocean Bottom Deformation Due To Present-Day Mass Redistribution and Its Impact on Sea Level Observations
Authors Thomas Frederikse, Riccardo E. M. Riva, Matt A. King
First published: 23 December 2017
Abstract
Present-day mass redistribution increases the total ocean mass and, on average, causes the ocean bottom to subside elastically. Therefore, barystatic sea level rise is larger than the resulting global mean geocentric sea level rise, observed by satellite altimetry and GPS-corrected tide gauges. We use realistic estimates of mass redistribution from ice mass loss and land water storage to quantify the resulting ocean bottom deformation and its effect on global and regional ocean volume change estimates. Over 1993–2014, the resulting globally averaged geocentric sea level change is 8% smaller than the barystatic contribution. Over the altimetry domain, the difference is about 5%, and due to this effect, barystatic sea level rise will be underestimated by more than 0.1 mm/yr over 1993–2014. Regional differences are often larger: up to 1 mm/yr over the Arctic Ocean and 0.4 mm/yr in the South Pacific. Ocean bottom deformation should be considered when regional sea level changes are observed in a geocentric reference frame.
Then the ocean bottom near Greenland and Antarctica must be rising.